Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ARHGAP29 cdna clone

ARHGAP29 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ARHGAP29; PARG1
Synonyms
ARHGAP29; N/A; ARHGAP29 cDNA Clone; ARHGAP29 cdna clone
Ordering
Sequence
atgattgctcacaaacagaaaaagacaaagaaaaaacgtgcttgggcatcaggtcaactctctactgatattacaacttctgaaatggggctcaagtccttaagttccaactctatttttgatccggattacatcaaggagttggtgaatgatatcaggaagttctcccacatgttactatatttgaaagaagccatattttcagactgttttaaagaagttattcatatacgtctagaggaactgctccgtgttttaaagtctataatgaataaacatcagaacctcaattctgttgatcttcaaaatgctgcagaaatgctcactgcaaaagtgaaagctgtgaacttcacagaagttaatgaagaaaacaaaaacgatctcttccaggaagtgttttcttctattgaaactttggcatttacctttggaaatatccttacaaacttccttatgggagatgtaggcaatgattcattattgcgactgcctgtttctcgagaaactaagtcgtttgaaaatgtttctgtggaatcagtggactcatccagtgaaaaaggaaatttttcccctttagaactagacaacgtgctgttaaagaacactgactctatcgagctggctttgtcatatgctaaaacttggtcaaaatatactaagaacatagtttcatgggttgaaaaaaagcttaacttggaattggagtccactagaaatatggtcaagttggcagaggcaactagaactaacattggaattcaggagttcatgccactgcagtctctgtttactaatgctcttcttaatgatatagaaagcagtcaccttttacaacaaacaattgcagctctccaggctaacaaatttgtgcagcctctacttggaaggaaaaatgaaatggaaaaacaaaggaaagaaataaaagagctttggaaacaggagcaaaataaaatgcttgaagcagagaatgctctcaaaaaggcaaaattattatgcatgcaacgtcaagatgaatatgagaaagcaaagtcttccatgtttcgtgcagaagaggagcatctgtcttcaagtggcggattagcaaaaaatctcaacaagcaactagaaaaaaagcgaaggttggaagaggaggctctccaaaaagtaacgatctttttcttttttatttgcaagttgaattag
Sequence Length
1182
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,194 Da
NCBI Official Full Name
Homo sapiens Rho GTPase activating protein 29, mRNA
NCBI Official Synonym Full Names
Rho GTPase activating protein 29
NCBI Official Symbol
ARHGAP29
NCBI Official Synonym Symbols
PARG1
NCBI Protein Information
rho GTPase-activating protein 29
UniProt Protein Name
Rho GTPase-activating protein 29
UniProt Gene Name
ARHGAP29
UniProt Synonym Gene Names
PARG1
UniProt Entry Name
RHG29_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The ARHGAP29 arhgap29 (Catalog #AAA116391) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgctc acaaacagaa aaagacaaag aaaaaacgtg cttgggcatc aggtcaactc tctactgata ttacaacttc tgaaatgggg ctcaagtcct taagttccaa ctctattttt gatccggatt acatcaagga gttggtgaat gatatcagga agttctccca catgttacta tatttgaaag aagccatatt ttcagactgt tttaaagaag ttattcatat acgtctagag gaactgctcc gtgttttaaa gtctataatg aataaacatc agaacctcaa ttctgttgat cttcaaaatg ctgcagaaat gctcactgca aaagtgaaag ctgtgaactt cacagaagtt aatgaagaaa acaaaaacga tctcttccag gaagtgtttt cttctattga aactttggca tttacctttg gaaatatcct tacaaacttc cttatgggag atgtaggcaa tgattcatta ttgcgactgc ctgtttctcg agaaactaag tcgtttgaaa atgtttctgt ggaatcagtg gactcatcca gtgaaaaagg aaatttttcc cctttagaac tagacaacgt gctgttaaag aacactgact ctatcgagct ggctttgtca tatgctaaaa cttggtcaaa atatactaag aacatagttt catgggttga aaaaaagctt aacttggaat tggagtccac tagaaatatg gtcaagttgg cagaggcaac tagaactaac attggaattc aggagttcat gccactgcag tctctgttta ctaatgctct tcttaatgat atagaaagca gtcacctttt acaacaaaca attgcagctc tccaggctaa caaatttgtg cagcctctac ttggaaggaa aaatgaaatg gaaaaacaaa ggaaagaaat aaaagagctt tggaaacagg agcaaaataa aatgcttgaa gcagagaatg ctctcaaaaa ggcaaaatta ttatgcatgc aacgtcaaga tgaatatgag aaagcaaagt cttccatgtt tcgtgcagaa gaggagcatc tgtcttcaag tggcggatta gcaaaaaatc tcaacaagca actagaaaaa aagcgaaggt tggaagagga ggctctccaa aaagtaacga tctttttctt ttttatttgc aagttgaatt ag. It is sometimes possible for the material contained within the vial of "ARHGAP29, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.