Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us
product-image-AAA116398_AD15.jpg Application Data (Map)

BPI cdna clone

BPI cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
BPI; rBPI; BPIFD1
Synonyms
BPI; N/A; BPI cDNA Clone; BPI cdna clone
Ordering
Sequence
atgagagagaacttggccaggggcccttgcaacgcgccgagatgggcgtccctgatggtgctggtcgccataggcaccgccgtgacagcggccgtcaaccctggcgtcgtggtcaggatctcccagaagggcctggactacgccagccagcaggggacggccgctctgcagaaggagctgaagaggatcaagattcctgactactcagacagctttaagatcaagcatcttgggaaggggcattatagcttctacagcatggacatccgtgaattccagcttcccagttcccagataagcatggtgcccaatgtgggccttaagttctccatcagcaacgccaatatcaagatcagcgggaaatggaaggcacaaaagagattcttaaaaatgagcggcaattttgacctgagcatagaaggcatgtccatttcggctgatctgaagctgggcagtaaccccacgtcaggcaagcccaccatcacctgctccagctgcagcagccacatcaacagtgtccacgtgcacatctcaaagagcaaagtggggtggctgatccaactcttccacaaaaaaattgagtctgcgcttcgaaacaagatgaacagccaggtctgcgagaaagtgaccaattctgtatcctccaagctgcaaccttatttccagactctgccagtaatgaccaaaatagattctgtggctggaatcaactatggtctggtggcacctccagcaaccacggctgagaccctggatgtacagatgaagggggagttttacagtgagaaccaccacaatccacctccctttgctccaccagtgatggagtttcccgctgcccatgaccgcatggtatacctgggcctctcagactacttcttcaacacagccgggcttgtataccaagaggctggggtcttgaagatgacccttagagatgacatgattccaaaggagtccaaatttcgactgacaaccaagttctttggaaccttcctacctgaggtggccaagaagtttcccaacatgaagatacagatccatgtctcagcctccaccccgccacacctgtctgtgcagcccaccggccttaccttctaccctgccgtggatgtccaggcctttgccgtcctccccaactcctccctggcttccctcttcctgattggcatgcacacaactggttccatggaggtcagcgccgagtccaacaggcttgttggagagctcaagctggataggctgctcctggaactgaagcactcaaatattggccccttcccggttgaattgctgcaggatatcatgaactacattgtacccattcttgtgctgcccagggttaacgagaaactacagaaaggcttccctctcccgacgccggccagagtccagctctacaacgtagtgcttcagcctcaccagaacttcctgctgttcggtgcagacgttgtctataaatga
Sequence Length
1464
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

Application Data

(Map)

product-image-AAA116398_AD15.jpg Application Data (Map)

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
671
Molecular Weight
53,900 Da
NCBI Official Full Name
Homo sapiens bactericidal/permeability-increasing protein, mRNA
NCBI Official Synonym Full Names
bactericidal/permeability-increasing protein
NCBI Official Symbol
BPI
NCBI Official Synonym Symbols
rBPI; BPIFD1
NCBI Protein Information
bactericidal permeability-increasing protein
UniProt Protein Name
Bactericidal permeability-increasing protein
UniProt Gene Name
BPI
UniProt Synonym Gene Names
BPI
UniProt Entry Name
BPI_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The BPI bpi (Catalog #AAA116398) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagagaga acttggccag gggcccttgc aacgcgccga gatgggcgtc cctgatggtg ctggtcgcca taggcaccgc cgtgacagcg gccgtcaacc ctggcgtcgt ggtcaggatc tcccagaagg gcctggacta cgccagccag caggggacgg ccgctctgca gaaggagctg aagaggatca agattcctga ctactcagac agctttaaga tcaagcatct tgggaagggg cattatagct tctacagcat ggacatccgt gaattccagc ttcccagttc ccagataagc atggtgccca atgtgggcct taagttctcc atcagcaacg ccaatatcaa gatcagcggg aaatggaagg cacaaaagag attcttaaaa atgagcggca attttgacct gagcatagaa ggcatgtcca tttcggctga tctgaagctg ggcagtaacc ccacgtcagg caagcccacc atcacctgct ccagctgcag cagccacatc aacagtgtcc acgtgcacat ctcaaagagc aaagtggggt ggctgatcca actcttccac aaaaaaattg agtctgcgct tcgaaacaag atgaacagcc aggtctgcga gaaagtgacc aattctgtat cctccaagct gcaaccttat ttccagactc tgccagtaat gaccaaaata gattctgtgg ctggaatcaa ctatggtctg gtggcacctc cagcaaccac ggctgagacc ctggatgtac agatgaaggg ggagttttac agtgagaacc accacaatcc acctcccttt gctccaccag tgatggagtt tcccgctgcc catgaccgca tggtatacct gggcctctca gactacttct tcaacacagc cgggcttgta taccaagagg ctggggtctt gaagatgacc cttagagatg acatgattcc aaaggagtcc aaatttcgac tgacaaccaa gttctttgga accttcctac ctgaggtggc caagaagttt cccaacatga agatacagat ccatgtctca gcctccaccc cgccacacct gtctgtgcag cccaccggcc ttaccttcta ccctgccgtg gatgtccagg cctttgccgt cctccccaac tcctccctgg cttccctctt cctgattggc atgcacacaa ctggttccat ggaggtcagc gccgagtcca acaggcttgt tggagagctc aagctggata ggctgctcct ggaactgaag cactcaaata ttggcccctt cccggttgaa ttgctgcagg atatcatgaa ctacattgta cccattcttg tgctgcccag ggttaacgag aaactacaga aaggcttccc tctcccgacg ccggccagag tccagctcta caacgtagtg cttcagcctc accagaactt cctgctgttc ggtgcagacg ttgtctataa atga. It is sometimes possible for the material contained within the vial of "BPI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.