C16orf70 cdna clone
C16orf70 cDNA Clone
Gene Names
C16orf70; LIN10; lin-10; C16orf6
Synonyms
C16orf70; N/A; C16orf70 cDNA Clone; C16orf70 cdna clone
Sequence
atgctggacctggaggtagtgcccgaacgctctctggggaacgagcaatgggaattcacgctgggaatgcctctggctcaggcagtagccattcttcagaagcactgtcgcatcatcaaaaacgtccaggttctctacagtgaacagtctcctctaagccatgacctcattcttaacctgactcaggacgggatcaaactaatgtttgatgctttcaatcagagacttaaggtgatcgaagtatgtgatttgactaaagtaaagttaaaatattgtggcgtgcattttaattctcaggccatagctcctaccattgaacagattgaccagtcttttggcgcaacccatcctggagtgtacaactccgctgagcagctcttccatctcaacttcagaggactgtctttctcttttcagttagactcatggactgaggctccaaagtatgagcccaattttgcccatggcctggcttctctccagataccccatggagcaactgtaaaacgaatgtacatctacagtggcaacagcctgcaggataccaaggctcccatgatgcctctgagctgtttcctgggcaatgtctatgctgagagtgtagatgttcttcgagatggaactggacctgcaggtttacgacttcgcctacttgctgcaggttgtggacctggcctattagcagatgccaagatgcgggtatttgaacgttcagtgtattttggtgattcctgccaagatgttcttagcatgcttggctctccacacaaagtcttctataaatcagaagacaagatgaaaattcattctccttcccctcataaacaagttccatcgaagtgtaatgactacttttttaactacttcactcttggagtggacatcctctttgatgcgaatacacacaaagtgaagaagtttgttctacacaccaattaccctgggcattataatttcaacatttatcatcgctgtgagttcaagatcccactagccataaagaaagaaaacgcagatggtcagacagaaacatgcacgacctacagcaagtgggacaacatccaggagctcctgggccaccctgtggagaagcctgttgtcctgcacaggtcttcctccccaaacaacaccaacccatttggttccacattctgctttggtcttcagcgaatgatctttgaggtcatgcagaacaaccacattgcctcggtgaccctgtatggcccccccaggcctggtagccacctgagaacagcggaactcccctag
Sequence Length
1269
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,657 Da
NCBI Official Full Name
Homo sapiens chromosome 16 open reading frame 70, mRNA
NCBI Official Synonym Full Names
chromosome 16 open reading frame 70
NCBI Official Symbol
C16orf70
NCBI Official Synonym Symbols
LIN10; lin-10; C16orf6
NCBI Protein Information
UPF0183 protein C16orf70
UniProt Protein Name
UPF0183 protein C16orf70
UniProt Gene Name
C16orf70
UniProt Synonym Gene Names
C16orf6
UniProt Entry Name
CP070_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The C16orf70 c16orf70 (Catalog #AAA116482) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggacc tggaggtagt gcccgaacgc tctctgggga acgagcaatg ggaattcacg ctgggaatgc ctctggctca ggcagtagcc attcttcaga agcactgtcg catcatcaaa aacgtccagg ttctctacag tgaacagtct cctctaagcc atgacctcat tcttaacctg actcaggacg ggatcaaact aatgtttgat gctttcaatc agagacttaa ggtgatcgaa gtatgtgatt tgactaaagt aaagttaaaa tattgtggcg tgcattttaa ttctcaggcc atagctccta ccattgaaca gattgaccag tcttttggcg caacccatcc tggagtgtac aactccgctg agcagctctt ccatctcaac ttcagaggac tgtctttctc ttttcagtta gactcatgga ctgaggctcc aaagtatgag cccaattttg cccatggcct ggcttctctc cagatacccc atggagcaac tgtaaaacga atgtacatct acagtggcaa cagcctgcag gataccaagg ctcccatgat gcctctgagc tgtttcctgg gcaatgtcta tgctgagagt gtagatgttc ttcgagatgg aactggacct gcaggtttac gacttcgcct acttgctgca ggttgtggac ctggcctatt agcagatgcc aagatgcggg tatttgaacg ttcagtgtat tttggtgatt cctgccaaga tgttcttagc atgcttggct ctccacacaa agtcttctat aaatcagaag acaagatgaa aattcattct ccttcccctc ataaacaagt tccatcgaag tgtaatgact acttttttaa ctacttcact cttggagtgg acatcctctt tgatgcgaat acacacaaag tgaagaagtt tgttctacac accaattacc ctgggcatta taatttcaac atttatcatc gctgtgagtt caagatccca ctagccataa agaaagaaaa cgcagatggt cagacagaaa catgcacgac ctacagcaag tgggacaaca tccaggagct cctgggccac cctgtggaga agcctgttgt cctgcacagg tcttcctccc caaacaacac caacccattt ggttccacat tctgctttgg tcttcagcga atgatctttg aggtcatgca gaacaaccac attgcctcgg tgaccctgta tggccccccc aggcctggta gccacctgag aacagcggaa ctcccctag. It is sometimes possible for the material contained within the vial of "C16orf70, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.