Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

C21orf63 cdna clone

C21orf63 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
EVA1C; B18; B19; SUE21; PRED34; FAM176C; C21orf63; C21orf64
Synonyms
C21orf63; N/A; C21orf63 cDNA Clone; C21orf63 cdna clone
Ordering
Sequence
atgcttctgccgggacgcgcacgccaaccgccgacgccccagcccgtgcagcatcacggcctccgccggcaggtagagccgccggggcagctcctgcgcctcttctactgcactgtcctggtctgctccaaagagatctcagcgctcaccgacttctctggttacctaaccaaactcctgcaaaaccacaccacctatgcctgtgatggggactatttgaatctacagtgccctcggcattctacgataagtgtccaatcggcattttatgggcaagattaccaaatgtgtagttcccagaagcctgcctcccagagggaagacagcttaacctgtgtggcagccaccaccttccagaaggtgctggacgaatgccagaaccagcgggcctgccacctcctggtcaatagccgtgtttttggacctgacctttgtccaggaagcagtaaatacctcctggtctcctttaaatgccaacctaatgaattaaaaaacaaaaccgtgtgtgaagaccaggagctgaaactgcactgccatgaatccaagttcctcaacatctactctgcgacctacggcaggaggacccaggaaagggacatctgctcctccaaggcagagcggctcccccctttcgattgcttgtcttactcagctttgcaagtcctatcccgaaggtgctatgggaagcagagatgcaaaatcatcgtcaacaatcaccattttggaagcccctgtttgccaggcgtgaaaaaatacctcactgtgacctacgcatgtgttcccaagaacatactcacagcgattgatccagccattgctaatctaaaaccttctttgaagcagaaagatggtataaacttcgacccaagcggatcgaaggttctgaggaaagatggaattcttgttagcaactctctggcagcctttgcttacattagagcccacccggagagagctgccctgctgttcgtgtccagtgtctgcatcggcctggccctcacactgtgcgccctggtcatcagagagtcctgtgccaaggacttccgcgacttgcagctggggagggagcagctggtgccaggaagtgacaaggtcgaggaggacagcgaggatgaagaagaggaggaggacccctctgagtctgatttcccaggggaactgtcggggttctgtaggacttcatatcctatatacagttccatagaagctgcagagctcgcagaaaggattgagcgcagggagcaaatcattcaggaaatatggatgaacagtggtttggacacctcgctcccaagaaacatgggccagttctactga
Sequence Length
1317
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,134 Da
NCBI Official Full Name
Homo sapiens chromosome 21 open reading frame 63, mRNA
NCBI Official Synonym Full Names
eva-1 homolog C
NCBI Official Symbol
EVA1C
NCBI Official Synonym Symbols
B18; B19; SUE21; PRED34; FAM176C; C21orf63; C21orf64
NCBI Protein Information
protein eva-1 homolog C
UniProt Protein Name
Protein eva-1 homolog C
UniProt Gene Name
EVA1C
UniProt Synonym Gene Names
C21orf63; C21orf64; FAM176C
UniProt Entry Name
EVA1C_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The C21orf63 eva1c (Catalog #AAA116459) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttctgc cgggacgcgc acgccaaccg ccgacgcccc agcccgtgca gcatcacggc ctccgccggc aggtagagcc gccggggcag ctcctgcgcc tcttctactg cactgtcctg gtctgctcca aagagatctc agcgctcacc gacttctctg gttacctaac caaactcctg caaaaccaca ccacctatgc ctgtgatggg gactatttga atctacagtg ccctcggcat tctacgataa gtgtccaatc ggcattttat gggcaagatt accaaatgtg tagttcccag aagcctgcct cccagaggga agacagctta acctgtgtgg cagccaccac cttccagaag gtgctggacg aatgccagaa ccagcgggcc tgccacctcc tggtcaatag ccgtgttttt ggacctgacc tttgtccagg aagcagtaaa tacctcctgg tctcctttaa atgccaacct aatgaattaa aaaacaaaac cgtgtgtgaa gaccaggagc tgaaactgca ctgccatgaa tccaagttcc tcaacatcta ctctgcgacc tacggcagga ggacccagga aagggacatc tgctcctcca aggcagagcg gctcccccct ttcgattgct tgtcttactc agctttgcaa gtcctatccc gaaggtgcta tgggaagcag agatgcaaaa tcatcgtcaa caatcaccat tttggaagcc cctgtttgcc aggcgtgaaa aaatacctca ctgtgaccta cgcatgtgtt cccaagaaca tactcacagc gattgatcca gccattgcta atctaaaacc ttctttgaag cagaaagatg gtataaactt cgacccaagc ggatcgaagg ttctgaggaa agatggaatt cttgttagca actctctggc agcctttgct tacattagag cccacccgga gagagctgcc ctgctgttcg tgtccagtgt ctgcatcggc ctggccctca cactgtgcgc cctggtcatc agagagtcct gtgccaagga cttccgcgac ttgcagctgg ggagggagca gctggtgcca ggaagtgaca aggtcgagga ggacagcgag gatgaagaag aggaggagga cccctctgag tctgatttcc caggggaact gtcggggttc tgtaggactt catatcctat atacagttcc atagaagctg cagagctcgc agaaaggatt gagcgcaggg agcaaatcat tcaggaaata tggatgaaca gtggtttgga cacctcgctc ccaagaaaca tgggccagtt ctactga. It is sometimes possible for the material contained within the vial of "C21orf63, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.