CD19 cDNA Clone – Homo Sapiens CD19 Molecule, Mrna
CD19 cDNA Clone
Gene Names
CD19; B4; CVID3
Synonyms
CD19; N/A; CD19 cDNA Clone; CD19 cdna clone
Product Overview
Sequence
atgccacctcctcgcctcctcttcttcctcctcttcctcacccccatggaagtcaggcccgaggaacctctagtggtgaaggtggaagagggagataacgctgtgctgcagtgcctcaaggggacctcagatggccccactcagcagctgacctggtctcgggagtccccgcttaaacccttcttaaaactcagcctggggctgccaggcctgggaatccacatgaggcccctggccatctggcttttcatcttcaacgtctctcaacagatggggggcttctacctgtgccagccggggcccccctctgagaaggcctggcagcctggctggacagtcaatgtggagggcagcggggagctgttccggtggaatgtttcggacctaggtggcctgggctgtggcctgaagaacaggtcctcagagggccccagctccccttccgggaagctcatgagccccaagctgtatgtgtgggccaaagaccgccctgagatctgggagggagagcctccgtgtctcccaccgagggacagcctgaaccagagcctcagccaggacctcaccatggcccctggctccacactctggctgtcctgtggggtaccccctgactctgtgtccaggggccccctctcctggacccatgtgcaccccaaggggcctaagtcattgctgagcctagagctgaaggacgatcgcccggccagagatatgtgggtaatggagacgggtctgttgttgccccgggccacagctcaagacgctggaaagtattattgtcaccgtggcaacctgaccatgtcattccacctggagatcactgctcggccagtactatggcactggctgctgaggactggtggctggaaggtctcagctgtgactttggcttatctgatcttctgcctgtgttcccttgtgggcattcttcatcttcaaagagccctggtcctgaggaggaaaagaaagcgaatgactgaccccaccaggagattcttcaaagtgacgcctcccccaggaagcgggccccagaaccagtacgggaacgtgctgtctctccccacacccacctcaggcctcggacgcgcccagcgttgggccgcaggcctggggggcactgccccgtcttatggaaacccgagcagcgacgtccaggcggatggagccttggggtcccggagcccgccgggagtgggcccagaagaagaggaaggggagggctatgaggaacctgacagtgaggaggactccgagttctatgagaacgactccaaccttgggcaggaccagctctcccaggatggcagcggctacgagaaccctgaggatgagcccctgggtcctgaggatgaagactccttctccaacgctgagtcttatgagaacgaggatgaagagctgacccagccggtcgccaggacaatggacttcctgagccctcatgggtcagcctgggaccccagccgggaagcaacctccctggggtcccagtcctatgaggatatgagaggaatcctgtatgcagccccccagctccgctccattcggggccagcctggacccaatcatgaggaagatgcagactcttatgagaacatggataatcccgatgggccagacccagcctggggaggagggggccgcatgggcacctggagcaccaggtga
Sequence Length
1671
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,200 Da
NCBI Official Full Name
Homo sapiens CD19 molecule, mRNA
NCBI Official Synonym Full Names
CD19 molecule
NCBI Official Symbol
CD19
NCBI Official Synonym Symbols
B4; CVID3
NCBI Protein Information
B-lymphocyte antigen CD19
UniProt Protein Name
B-lymphocyte antigen CD19
UniProt Gene Name
CD19
UniProt Entry Name
CD19_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The CD19 cd19 (Catalog #AAA116384) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccacctc ctcgcctcct cttcttcctc ctcttcctca cccccatgga agtcaggccc gaggaacctc tagtggtgaa ggtggaagag ggagataacg ctgtgctgca gtgcctcaag gggacctcag atggccccac tcagcagctg acctggtctc gggagtcccc gcttaaaccc ttcttaaaac tcagcctggg gctgccaggc ctgggaatcc acatgaggcc cctggccatc tggcttttca tcttcaacgt ctctcaacag atggggggct tctacctgtg ccagccgggg cccccctctg agaaggcctg gcagcctggc tggacagtca atgtggaggg cagcggggag ctgttccggt ggaatgtttc ggacctaggt ggcctgggct gtggcctgaa gaacaggtcc tcagagggcc ccagctcccc ttccgggaag ctcatgagcc ccaagctgta tgtgtgggcc aaagaccgcc ctgagatctg ggagggagag cctccgtgtc tcccaccgag ggacagcctg aaccagagcc tcagccagga cctcaccatg gcccctggct ccacactctg gctgtcctgt ggggtacccc ctgactctgt gtccaggggc cccctctcct ggacccatgt gcaccccaag gggcctaagt cattgctgag cctagagctg aaggacgatc gcccggccag agatatgtgg gtaatggaga cgggtctgtt gttgccccgg gccacagctc aagacgctgg aaagtattat tgtcaccgtg gcaacctgac catgtcattc cacctggaga tcactgctcg gccagtacta tggcactggc tgctgaggac tggtggctgg aaggtctcag ctgtgacttt ggcttatctg atcttctgcc tgtgttccct tgtgggcatt cttcatcttc aaagagccct ggtcctgagg aggaaaagaa agcgaatgac tgaccccacc aggagattct tcaaagtgac gcctccccca ggaagcgggc cccagaacca gtacgggaac gtgctgtctc tccccacacc cacctcaggc ctcggacgcg cccagcgttg ggccgcaggc ctggggggca ctgccccgtc ttatggaaac ccgagcagcg acgtccaggc ggatggagcc ttggggtccc ggagcccgcc gggagtgggc ccagaagaag aggaagggga gggctatgag gaacctgaca gtgaggagga ctccgagttc tatgagaacg actccaacct tgggcaggac cagctctccc aggatggcag cggctacgag aaccctgagg atgagcccct gggtcctgag gatgaagact ccttctccaa cgctgagtct tatgagaacg aggatgaaga gctgacccag ccggtcgcca ggacaatgga cttcctgagc cctcatgggt cagcctggga ccccagccgg gaagcaacct ccctggggtc ccagtcctat gaggatatga gaggaatcct gtatgcagcc ccccagctcc gctccattcg gggccagcct ggacccaatc atgaggaaga tgcagactct tatgagaaca tggataatcc cgatgggcca gacccagcct ggggaggagg gggccgcatg ggcacctgga gcaccaggtg a. It is sometimes possible for the material contained within the vial of "CD19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.