Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

CD200R1 cdna clone

CD200R1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
CD200R1; OX2R; MOX2R; CD200R; HCRTR2
Synonyms
CD200R1; N/A; CD200R1 cDNA Clone; CD200R1 cdna clone
Ordering
Sequence
atgctctgcccttggagaactgctaacctagggctactgttgattttgactatcttcttagtggccgaagcggagggtgctgctcaaccaaacaactcattaatgctgcaaactagcaaggagaatcatgctttagcttcaagcagtttatgtatggatgaaaaacagattacacagaactactcgaaagtactcgcagaagttaacacttcatggcctgtaaagatggctacaaatgctgtgctttgttgccctcctatcgcattaagaaatttgatcataataacatgggaaataatcctgagaggccagccttcctgcacaaaagcctacaagaaagaaacaaatgagaccaaggaaaccaactgtactgatgagagaataacctgggtctccagacctgatcagaattcggaccttcagattcgtaccgtggccatcactcatgacgggtattacagatgcataatggtaacacctgatgggaatttccatcgtggatatcacctccaagtgttagttacacctgaagtgaccctgtttcaaaacaggaatagaactgcagtatgcaaggcagttgcagggaagccagctgcgcatatctcctggatcccagagggcgattgtgccactaagcaagaatactggagcaatggcacagtgactgttaagagtacatgccactgggaggtccacaatgtgtctaccgtgacctgccacgtctcccatttgactggcaacaagagtctgtacatagagctacttcctgttccaggtgccaaaaaatcagcaaaattatatattccatatatcatccttactattattattttgaccatcgtgggattcatttggttgttgaaagtcaatggctgcagaaaatataaattgaataaaacagaatctactccagttgttgaggaggatgaaatgcagccctatgccagctacacagagaagaacaatcctctctatgatactacaaacaaggtgaaggcatctgaggcattacaaagtgaagttgacacagacctccatactttataa
Sequence Length
1047
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,056 Da
NCBI Official Full Name
Homo sapiens CD200 receptor 1, mRNA
NCBI Official Synonym Full Names
CD200 receptor 1
NCBI Official Symbol
CD200R1
NCBI Official Synonym Symbols
OX2R; MOX2R; CD200R; HCRTR2
NCBI Protein Information
cell surface glycoprotein CD200 receptor 1
UniProt Protein Name
Cell surface glycoprotein CD200 receptor 1
UniProt Gene Name
CD200R1
UniProt Synonym Gene Names
CD200R; CRTR2; MOX2R; OX2R
UniProt Entry Name
MO2R1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The CD200R1 cd200r1 (Catalog #AAA116473) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctctgcc cttggagaac tgctaaccta gggctactgt tgattttgac tatcttctta gtggccgaag cggagggtgc tgctcaacca aacaactcat taatgctgca aactagcaag gagaatcatg ctttagcttc aagcagttta tgtatggatg aaaaacagat tacacagaac tactcgaaag tactcgcaga agttaacact tcatggcctg taaagatggc tacaaatgct gtgctttgtt gccctcctat cgcattaaga aatttgatca taataacatg ggaaataatc ctgagaggcc agccttcctg cacaaaagcc tacaagaaag aaacaaatga gaccaaggaa accaactgta ctgatgagag aataacctgg gtctccagac ctgatcagaa ttcggacctt cagattcgta ccgtggccat cactcatgac gggtattaca gatgcataat ggtaacacct gatgggaatt tccatcgtgg atatcacctc caagtgttag ttacacctga agtgaccctg tttcaaaaca ggaatagaac tgcagtatgc aaggcagttg cagggaagcc agctgcgcat atctcctgga tcccagaggg cgattgtgcc actaagcaag aatactggag caatggcaca gtgactgtta agagtacatg ccactgggag gtccacaatg tgtctaccgt gacctgccac gtctcccatt tgactggcaa caagagtctg tacatagagc tacttcctgt tccaggtgcc aaaaaatcag caaaattata tattccatat atcatcctta ctattattat tttgaccatc gtgggattca tttggttgtt gaaagtcaat ggctgcagaa aatataaatt gaataaaaca gaatctactc cagttgttga ggaggatgaa atgcagccct atgccagcta cacagagaag aacaatcctc tctatgatac tacaaacaag gtgaaggcat ctgaggcatt acaaagtgaa gttgacacag acctccatac tttataa. It is sometimes possible for the material contained within the vial of "CD200R1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.