CLU cdna clone
CLU cDNA Clone
Synonyms
CLU; N/A; CLU cDNA Clone; CLU cdna clone
Sequence
atgatgaagactctgctgctgtttgtggggctgctgctgacctgggagagtgggcaggtcctgggggaccagacggtctcagacaatgagctccaggaaatgtccaatcagggaagtaagtacgtcaataaggaaattcaaaatgctgtcaacggggtgaaacagataaagactctcatagaaaaaacaaacgaagagcgcaagacactgctcagcaacctagaagaagccaagaagaagaaagaggatgccctaaatgagaccagggaatcagagacaaagctgaaggagctcccaggagtgtgcaatgagaccatgatggccctctgggaagagtgtaagccctgcctgaaacagacctgcatgaagttctacgcacgcgtctgcagaagtggctcaggcctggttggccgccagcttgaggagttcctgaaccagagctcgcccttctacttctggatgaatggtgaccgcatcgactccctgctggagaacgaccggcagcagacgcacatgctggatgtcatgcaggaccacttcagccgcgcgtccagcatcatagacgagctcttccaggacaggttcttcacccgggagccccaggatacctaccactacctgcccttcagcctgccccaccggaggcctcacttcttctttcccaagtcccgcatcgtccgcagcttgatgcccttctctccgtacgagcccctgaacttccacgccatgttccagcccttccttgagatgatacacgaggctcagcaggccatggacatccacttccacagcccggccttccagcacccgccaacagaattcatacgagaaggcgacgatgaccggactgtgtgccgggagatccgccacaactccacgggctgcctgcggatgaaggaccagtgtgacaagtgccgggagatcttgtctgtggactgttccaccaacaacccctcccaggctaagctgcggcgggagctcgacgaatccctccaggtcgctgagaggttgaccaggaaatacaacgagctgctaaagtcctaccagtggaagatgctcaacacctcctccttgctggagcagctgaacgagcagtttaactgggtgtcccggctggcaaacctcacgcaaggcgaagaccagtactatctgcgggtcaccacggtggcttcccacacttctgactcggacgttccttccggtgtcactgaggtggtcgtgaagctctttgactctgatcccatcactgtgacggtccctgtagaagtctccaggaagaaccctaaatttatggagaccgtggcggagaaagcgctgcaggaataccgcaaaaagcaccgggaggagtga
Sequence Length
1350
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
Similar Products
Product Notes
The CLU (Catalog #AAA116226) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgaaga ctctgctgct gtttgtgggg ctgctgctga cctgggagag tgggcaggtc ctgggggacc agacggtctc agacaatgag ctccaggaaa tgtccaatca gggaagtaag tacgtcaata aggaaattca aaatgctgtc aacggggtga aacagataaa gactctcata gaaaaaacaa acgaagagcg caagacactg ctcagcaacc tagaagaagc caagaagaag aaagaggatg ccctaaatga gaccagggaa tcagagacaa agctgaagga gctcccagga gtgtgcaatg agaccatgat ggccctctgg gaagagtgta agccctgcct gaaacagacc tgcatgaagt tctacgcacg cgtctgcaga agtggctcag gcctggttgg ccgccagctt gaggagttcc tgaaccagag ctcgcccttc tacttctgga tgaatggtga ccgcatcgac tccctgctgg agaacgaccg gcagcagacg cacatgctgg atgtcatgca ggaccacttc agccgcgcgt ccagcatcat agacgagctc ttccaggaca ggttcttcac ccgggagccc caggatacct accactacct gcccttcagc ctgccccacc ggaggcctca cttcttcttt cccaagtccc gcatcgtccg cagcttgatg cccttctctc cgtacgagcc cctgaacttc cacgccatgt tccagccctt ccttgagatg atacacgagg ctcagcaggc catggacatc cacttccaca gcccggcctt ccagcacccg ccaacagaat tcatacgaga aggcgacgat gaccggactg tgtgccggga gatccgccac aactccacgg gctgcctgcg gatgaaggac cagtgtgaca agtgccggga gatcttgtct gtggactgtt ccaccaacaa cccctcccag gctaagctgc ggcgggagct cgacgaatcc ctccaggtcg ctgagaggtt gaccaggaaa tacaacgagc tgctaaagtc ctaccagtgg aagatgctca acacctcctc cttgctggag cagctgaacg agcagtttaa ctgggtgtcc cggctggcaa acctcacgca aggcgaagac cagtactatc tgcgggtcac cacggtggct tcccacactt ctgactcgga cgttccttcc ggtgtcactg aggtggtcgt gaagctcttt gactctgatc ccatcactgt gacggtccct gtagaagtct ccaggaagaa ccctaaattt atggagaccg tggcggagaa agcgctgcag gaataccgca aaaagcaccg ggaggagtga. It is sometimes possible for the material contained within the vial of "CLU, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.