Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

COL2A1 cdna clone

COL2A1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
COL2A1; AOM; ANFH; SEDC; STL1; COL11A3
Synonyms
COL2A1; N/A; COL2A1 cDNA Clone; COL2A1 cdna clone
Ordering
Sequence
atgtccgcctttgctggcttaggcccgagagagaagggccccgaccccctgcagtacatgcgggccgaccaggcagccggtggcctgagacagcatgacgccgaggtggatgccacactcaagtccctcaacaaccagattgagagcatccgcagccccgagggctcccgcaagaaccctgctcgcacctgcagagacctgaaactctgccaccctgagtggaagagtggagactactggattgaccccaaccaaggctgcaccttggacgccatgaaggttttctgcaacatggagactggcgagacttgcgtctaccccaatccagcaaacgttcccaagaagaactggtggagcagcaagagcaaggagaagaaacacatctggtttggagaaaccatcaatggtggcttccatttcagctatggagatgacaatctggctcccaacactgccaacgtccagatgaccttcctacgcctgctgtccacggaaggctcccagaacatcacctaccactgcaagaacagcattgcctatctggacgaagcagctggcaacctcaagaaggccctgctcatccagggctccaatgacgtggagatccgggcagagggcaatagcaggttcacgtacactgccctgaaggatggctgcacgaaacataccggtaagtggggcaagactgttatcgagtaccggtcacagaagacctcacgcctccccatcattgacattgcacccatggacataggagggcccgagcaggaattcggtgtggacatagggccggtctgcttcttgtaa
Sequence Length
807
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,781
NCBI Official Full Name
Homo sapiens collagen, type II, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type II alpha 1 chain
NCBI Official Symbol
COL2A1
NCBI Official Synonym Symbols
AOM; ANFH; SEDC; STL1; COL11A3
NCBI Protein Information
collagen alpha-1(II) chain
UniProt Protein Name
Collagen alpha-1(II) chain
UniProt Gene Name
COL2A1
UniProt Entry Name
CO2A1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The COL2A1 col2a1 (Catalog #AAA116430) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgcct ttgctggctt aggcccgaga gagaagggcc ccgaccccct gcagtacatg cgggccgacc aggcagccgg tggcctgaga cagcatgacg ccgaggtgga tgccacactc aagtccctca acaaccagat tgagagcatc cgcagccccg agggctcccg caagaaccct gctcgcacct gcagagacct gaaactctgc caccctgagt ggaagagtgg agactactgg attgacccca accaaggctg caccttggac gccatgaagg ttttctgcaa catggagact ggcgagactt gcgtctaccc caatccagca aacgttccca agaagaactg gtggagcagc aagagcaagg agaagaaaca catctggttt ggagaaacca tcaatggtgg cttccatttc agctatggag atgacaatct ggctcccaac actgccaacg tccagatgac cttcctacgc ctgctgtcca cggaaggctc ccagaacatc acctaccact gcaagaacag cattgcctat ctggacgaag cagctggcaa cctcaagaag gccctgctca tccagggctc caatgacgtg gagatccggg cagagggcaa tagcaggttc acgtacactg ccctgaagga tggctgcacg aaacataccg gtaagtgggg caagactgtt atcgagtacc ggtcacagaa gacctcacgc ctccccatca ttgacattgc acccatggac ataggagggc ccgagcagga attcggtgtg gacatagggc cggtctgctt cttgtaa. It is sometimes possible for the material contained within the vial of "COL2A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.