Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

CTNND1 cdna clone

CTNND1 cDNA Clone

Gene Names
CTNND1; CAS; p120; CTNND; P120CAS; P120CTN; p120(CAS); p120(CTN)
Synonyms
CTNND1; N/A; CTNND1 cDNA Clone; CTNND1 cdna clone
Ordering
Sequence
atgattggtgaggaggtgccatcggatcaatactactgggctcctttggcccagcatgagcgaggaagtttagcaagcttggatagcctgcgcaaaggagggcctccacctcctaattggagacagccagagctgccagaggtgatcgccatgcttggattccgcttggatgctgtcaagtccaatgcagctgcatacctgcaacacttatgctaccgcaatgacaaggtgaagactgacgtgcggaagctcaagggcatcccagtactggtgggattgttagaccatcccaaaaaggaagtgcaccttggagcctgtggagctctcaagaatatctcttttggacgtgaccaggataacaagattgccataaaaaactgtgatggtgtgcctgcccttgtgcgattgcttcgaaaggctcgtgatatggaccttactgaagttattaccggaaccctgtggaatctttcatcccatgactcaatcaaaatggagattgtggaccatgcactgcatgccttgacagatgaagtgatcattcctcattctggttgggagcgggaacctaatgaagactgtaagccacgccatattgagtgggaatcggtgctcaccaacacagctggctgccttaggaatgtaagctcagagaggagtgaagctcgccggaaacttcgggaatgtgatggtttagttgatgccctcattttcattgttcaggctgagattgggcagaaggattcagacagcaagcttgtagagaactgtgtttgccttcttcggaacttatcatatcaagttcaccgggagatcccacaggcagagcgttaccaagaggcagctcccaatgttgccaacaatactgggccacatgctgccagttgctttggggccaagaagggcaaagggaaaaaacctatagaggatccagcaaacgatacagtggatttccctaaaagaacgagtccagctcgaggctatgagctcttatttcagccagaggtggttcggatatacatctcacttcttaaggagagcaagactcctgccatcctagaagcctcagctggagctatccagaacttgtgtgctgggcgctggacgtatggtcgatacatccgctctgctctgcgtcaagagaaggctctttctgccatagctgacctcctgactaatgaacatgaacgggtggtgaaagctgcatctggagcactgagaaacctggctgtggatgctcgcaacaaagaattaattggtaaacatgctattcctaacttggtaaagaatctgccaggaggacagcagaactcctcttggaatttctctgaggacactgtcatctctattttgaacactatcaacgaggttatcgctgagaacttggaggctgccaaaaagcttcgagagacacagggtattgagaagctggtgttgatcaacaaatcagggaaccgctcagaaaaagaagttcgagcagcagcacttgtattacagacaatctggggatataaggaactgcggaagccactggaaaaagaaggatggaagaaatcagactttcaggtgaatctaaacaatgcttcccgaagccagagcagtcattcatatgatgatagtactctccctctcattgaccggaaccaaaaatcagataagaaacctgatcgggaagaaattcagatgagcaatatgggatcaaacacaaaatcactagataacaactattccacaccaaatgagagaggagaccacaataaaacactggatcgatcgggggatctaggcgacatggagccattgaagggaacaacacccttgatgcagaagatttag
Sequence Length
1833
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,641 Da
NCBI Official Full Name
Homo sapiens catenin (cadherin-associated protein), delta 1, mRNA
NCBI Official Synonym Full Names
catenin delta 1
NCBI Official Symbol
CTNND1
NCBI Official Synonym Symbols
CAS; p120; CTNND; P120CAS; P120CTN; p120(CAS); p120(CTN)
NCBI Protein Information
catenin delta-1
UniProt Protein Name
Catenin delta-1
UniProt Gene Name
CTNND1
UniProt Synonym Gene Names
KIAA0384; CAS; p120(ctn)
UniProt Entry Name
CTND1_HUMAN

Similar Products

Product Notes

The CTNND1 ctnnd1 (Catalog #AAA116267) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattggtg aggaggtgcc atcggatcaa tactactggg ctcctttggc ccagcatgag cgaggaagtt tagcaagctt ggatagcctg cgcaaaggag ggcctccacc tcctaattgg agacagccag agctgccaga ggtgatcgcc atgcttggat tccgcttgga tgctgtcaag tccaatgcag ctgcatacct gcaacactta tgctaccgca atgacaaggt gaagactgac gtgcggaagc tcaagggcat cccagtactg gtgggattgt tagaccatcc caaaaaggaa gtgcaccttg gagcctgtgg agctctcaag aatatctctt ttggacgtga ccaggataac aagattgcca taaaaaactg tgatggtgtg cctgcccttg tgcgattgct tcgaaaggct cgtgatatgg accttactga agttattacc ggaaccctgt ggaatctttc atcccatgac tcaatcaaaa tggagattgt ggaccatgca ctgcatgcct tgacagatga agtgatcatt cctcattctg gttgggagcg ggaacctaat gaagactgta agccacgcca tattgagtgg gaatcggtgc tcaccaacac agctggctgc cttaggaatg taagctcaga gaggagtgaa gctcgccgga aacttcggga atgtgatggt ttagttgatg ccctcatttt cattgttcag gctgagattg ggcagaagga ttcagacagc aagcttgtag agaactgtgt ttgccttctt cggaacttat catatcaagt tcaccgggag atcccacagg cagagcgtta ccaagaggca gctcccaatg ttgccaacaa tactgggcca catgctgcca gttgctttgg ggccaagaag ggcaaaggga aaaaacctat agaggatcca gcaaacgata cagtggattt ccctaaaaga acgagtccag ctcgaggcta tgagctctta tttcagccag aggtggttcg gatatacatc tcacttctta aggagagcaa gactcctgcc atcctagaag cctcagctgg agctatccag aacttgtgtg ctgggcgctg gacgtatggt cgatacatcc gctctgctct gcgtcaagag aaggctcttt ctgccatagc tgacctcctg actaatgaac atgaacgggt ggtgaaagct gcatctggag cactgagaaa cctggctgtg gatgctcgca acaaagaatt aattggtaaa catgctattc ctaacttggt aaagaatctg ccaggaggac agcagaactc ctcttggaat ttctctgagg acactgtcat ctctattttg aacactatca acgaggttat cgctgagaac ttggaggctg ccaaaaagct tcgagagaca cagggtattg agaagctggt gttgatcaac aaatcaggga accgctcaga aaaagaagtt cgagcagcag cacttgtatt acagacaatc tggggatata aggaactgcg gaagccactg gaaaaagaag gatggaagaa atcagacttt caggtgaatc taaacaatgc ttcccgaagc cagagcagtc attcatatga tgatagtact ctccctctca ttgaccggaa ccaaaaatca gataagaaac ctgatcggga agaaattcag atgagcaata tgggatcaaa cacaaaatca ctagataaca actattccac accaaatgag agaggagacc acaataaaac actggatcga tcgggggatc taggcgacat ggagccattg aagggaacaa cacccttgat gcagaagatt tag. It is sometimes possible for the material contained within the vial of "CTNND1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.