CYR61 cDNA Clone – Homo Sapiens Cysteine-Rich, Angiogenic Inducer, 61, Mrna
CYR61 cDNA Clone
Gene Names
CYR61; CCN1; GIG1; IGFBP10
Synonyms
CYR61; N/A; CYR61 cDNA Clone; CYR61 cdna clone
Product Overview
Sequence
atgagctcccgcatcgccagggcgctcgccttagtcgtcacccttctccacttgaccaggctggcgctctccacctgccccgctgcctgccactgccccctggaggcgcccaagtgcgcgccgggagtcgggctggtccgggacggctgcggctgctgtaaggtctgcgccaagcagctcaacgaggactgcagcaaaacgcagccctgcgaccacaccaaggggctggaatgcaacttcggcgccagctccaccgctctgaaggggatctgcagagctcagtcagagggcagaccctgtgaatataactccagaatctaccaaaacggggaaagtttccagcccaactgtaaacatcagtgcacatgtattgatggcgccgtgggctgcattcctctgtgtccccaagaactatctctccccaacttgggctgtcccaaccctcggctggtcaaagttaccgggcagtgctgcgaggagtgggtctgtgacgaggatagtatcaaggaccccatggaggaccaggacggcctccttggcaaggagctgggattcgatgcctccgaggtggagttgacgagaaacaatgaattgattgcagttggaaaaggcagctcactgaagcggctccctgtttttggaatggagcctcgcatcctatacaaccctttacaaggccagaaatgtattgttcaaacaacttcatggtcccagtgctcaaagacctgtggaactggtatctccacacgagttaccaatgacaaccctgagtgccgccttgtgaaagaaacccggatttgtgaggtgcggccttgtggacagccagtgtacagcagcctgaaaaagggcaagaaatgcagcaagaccaagaaatcccccgaaccagtcaggtttacttacgctggatgtttgagtgtgaagaaataccggcccaagtactgcggttcctgcgtggacggccgatgctgcacgccccagctgaccaggactgtgaagatgcggttccgctgcgaagatggggagacattttccaagaacgtcatgatgatccagtcctgcaaatgcaactacaactgcccgcatgccaatgaagcagcgtttcccttctacaggctgttcaatgacattcacaaatttagggactaa
Sequence Length
1146
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,027 Da
NCBI Official Full Name
Homo sapiens cysteine-rich, angiogenic inducer, 61, mRNA
NCBI Official Synonym Full Names
cysteine rich angiogenic inducer 61
NCBI Official Symbol
CYR61
NCBI Official Synonym Symbols
CCN1; GIG1; IGFBP10
NCBI Protein Information
protein CYR61
UniProt Protein Name
Protein CYR61
UniProt Gene Name
CYR61
UniProt Synonym Gene Names
CCN1; GIG1; IGFBP10; IBP-10; IGF-binding protein 10; IGFBP-10
UniProt Entry Name
CYR61_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The CYR61 cyr61 (Catalog #AAA116257) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctccc gcatcgccag ggcgctcgcc ttagtcgtca cccttctcca cttgaccagg ctggcgctct ccacctgccc cgctgcctgc cactgccccc tggaggcgcc caagtgcgcg ccgggagtcg ggctggtccg ggacggctgc ggctgctgta aggtctgcgc caagcagctc aacgaggact gcagcaaaac gcagccctgc gaccacacca aggggctgga atgcaacttc ggcgccagct ccaccgctct gaaggggatc tgcagagctc agtcagaggg cagaccctgt gaatataact ccagaatcta ccaaaacggg gaaagtttcc agcccaactg taaacatcag tgcacatgta ttgatggcgc cgtgggctgc attcctctgt gtccccaaga actatctctc cccaacttgg gctgtcccaa ccctcggctg gtcaaagtta ccgggcagtg ctgcgaggag tgggtctgtg acgaggatag tatcaaggac cccatggagg accaggacgg cctccttggc aaggagctgg gattcgatgc ctccgaggtg gagttgacga gaaacaatga attgattgca gttggaaaag gcagctcact gaagcggctc cctgtttttg gaatggagcc tcgcatccta tacaaccctt tacaaggcca gaaatgtatt gttcaaacaa cttcatggtc ccagtgctca aagacctgtg gaactggtat ctccacacga gttaccaatg acaaccctga gtgccgcctt gtgaaagaaa cccggatttg tgaggtgcgg ccttgtggac agccagtgta cagcagcctg aaaaagggca agaaatgcag caagaccaag aaatcccccg aaccagtcag gtttacttac gctggatgtt tgagtgtgaa gaaataccgg cccaagtact gcggttcctg cgtggacggc cgatgctgca cgccccagct gaccaggact gtgaagatgc ggttccgctg cgaagatggg gagacatttt ccaagaacgt catgatgatc cagtcctgca aatgcaacta caactgcccg catgccaatg aagcagcgtt tcccttctac aggctgttca atgacattca caaatttagg gactaa. It is sometimes possible for the material contained within the vial of "CYR61, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.