DEPDC5 cdna clone
DEPDC5 cDNA Clone
Gene Names
DEPDC5; DEP.5; FFEVF
Synonyms
DEPDC5; N/A; DEPDC5 cDNA Clone; DEPDC5 cdna clone
Sequence
atgagaacaacaaaggtctacaaactcgtcatccacaagaagggctttgggggcagtgatgatgagctagttgtgaaccccaaagtgttccctcacatcaagcttggagacattgtagagattgcacaccccaacgatgaatacagccctctgcttttgcaggtcaagtctcttaaggaagatttacagaaggaaactatcagtgtggaccagactgtgactcaagtgttccggctgagaccttatcaggatgtctatgttaatgtcgtagaccctaaggatgtgacccttgacctagtggaattaacttttaaggatcagtatattggccgtggggatatgtggcgactaaagaaaagtttggtcagcacatgtgcctatatcacccagaaggtggagtttgctggcatcagagcacaggctggtgaactgtgggttaagaatgagaaggtcatgtgtggctacatcagtgaagataccagggtggtgtttcgttctacgtcggctatggtttacatatttattcagatgagctgtgaaatgtgggattttgatatttatggggatttgtattttgagaaagctgtgaatggtttccttgctgatctatttaccaagtggaaggagaagaactgtagtcatgaagtgacagtggtcctgttttctagaactttctatgatgcaaaatctgttgatgaatttcctgaaataaaccgagcctcaattcgacaggatcacaaggggagattctatgaagacttttacaaagtggtggtgcagaatgagagaagagaagaatggacttcacttctcgtaaccattaaaaaactcttcatccagtatccagtgttggtgcgactggaacaggcagagggctttcctcaaggagataattctacctcagcacaaggaaactacctggaggccatcaatctgtcattcaatgtgtttgataagcactacatcaaccgcaactttgaccgaactgggcagatgtcagtggtgatcacgcccggggtgggtgtctttgaagtggaccgcctactcatgatcctgaccaagcagcggatgatagataatggaattggtgtggatttggtgtgcatgggagagcaaccgttacatgctgtcccattgttcaagctccataatcggagtgctccccgtgattctcgtctgggcgatgactataatatccctcactggataaaccacagtttctacacatccaaaagccagctcttttgtaatagtttcaccccacgaataaaactggcaggaaagaagcccgcctctgagaaagcaaaaaatggccgtgatacatctctcgggagtccaaaagaatctgagaacgcccttcccatccaagtagattatgacgcctatgacgctcaagtgttcaggctgcccggcccatcccgggcccagtgcctcaccacctgcagatctgtgcgagagcgagagagtcacagtcgaaagagtgccagctcctgtgatgtttcatccagcccttccctaccaagccgcacactgcccactgaggaagtgaggagccaggcttctgacgacagctccctaggcaagagtgccaacatcctgatgatcccacacccccacctgcaccagtatgaagtcagcagctccttgggatacaccagcactcgagagcacctaggataa
Sequence Length
1680
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
177,910 Da
NCBI Official Full Name
Homo sapiens DEP domain containing 5, mRNA
NCBI Official Synonym Full Names
DEP domain containing 5
NCBI Official Symbol
DEPDC5
NCBI Official Synonym Symbols
DEP.5; FFEVF
NCBI Protein Information
DEP domain-containing protein 5
UniProt Protein Name
DEP domain-containing protein 5
UniProt Gene Name
DEPDC5
UniProt Synonym Gene Names
KIAA0645
UniProt Entry Name
DEPD5_HUMAN
Similar Products
Product Notes
The DEPDC5 depdc5 (Catalog #AAA116400) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaacaa caaaggtcta caaactcgtc atccacaaga agggctttgg gggcagtgat gatgagctag ttgtgaaccc caaagtgttc cctcacatca agcttggaga cattgtagag attgcacacc ccaacgatga atacagccct ctgcttttgc aggtcaagtc tcttaaggaa gatttacaga aggaaactat cagtgtggac cagactgtga ctcaagtgtt ccggctgaga ccttatcagg atgtctatgt taatgtcgta gaccctaagg atgtgaccct tgacctagtg gaattaactt ttaaggatca gtatattggc cgtggggata tgtggcgact aaagaaaagt ttggtcagca catgtgccta tatcacccag aaggtggagt ttgctggcat cagagcacag gctggtgaac tgtgggttaa gaatgagaag gtcatgtgtg gctacatcag tgaagatacc agggtggtgt ttcgttctac gtcggctatg gtttacatat ttattcagat gagctgtgaa atgtgggatt ttgatattta tggggatttg tattttgaga aagctgtgaa tggtttcctt gctgatctat ttaccaagtg gaaggagaag aactgtagtc atgaagtgac agtggtcctg ttttctagaa ctttctatga tgcaaaatct gttgatgaat ttcctgaaat aaaccgagcc tcaattcgac aggatcacaa ggggagattc tatgaagact tttacaaagt ggtggtgcag aatgagagaa gagaagaatg gacttcactt ctcgtaacca ttaaaaaact cttcatccag tatccagtgt tggtgcgact ggaacaggca gagggctttc ctcaaggaga taattctacc tcagcacaag gaaactacct ggaggccatc aatctgtcat tcaatgtgtt tgataagcac tacatcaacc gcaactttga ccgaactggg cagatgtcag tggtgatcac gcccggggtg ggtgtctttg aagtggaccg cctactcatg atcctgacca agcagcggat gatagataat ggaattggtg tggatttggt gtgcatggga gagcaaccgt tacatgctgt cccattgttc aagctccata atcggagtgc tccccgtgat tctcgtctgg gcgatgacta taatatccct cactggataa accacagttt ctacacatcc aaaagccagc tcttttgtaa tagtttcacc ccacgaataa aactggcagg aaagaagccc gcctctgaga aagcaaaaaa tggccgtgat acatctctcg ggagtccaaa agaatctgag aacgcccttc ccatccaagt agattatgac gcctatgacg ctcaagtgtt caggctgccc ggcccatccc gggcccagtg cctcaccacc tgcagatctg tgcgagagcg agagagtcac agtcgaaaga gtgccagctc ctgtgatgtt tcatccagcc cttccctacc aagccgcaca ctgcccactg aggaagtgag gagccaggct tctgacgaca gctccctagg caagagtgcc aacatcctga tgatcccaca cccccacctg caccagtatg aagtcagcag ctccttggga tacaccagca ctcgagagca cctaggataa. It is sometimes possible for the material contained within the vial of "DEPDC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.