ESM1 cdna clone
ESM1 cDNA Clone
Gene Names
ESM1; endocan
Synonyms
ESM1; N/A; ESM1 cDNA Clone; ESM1 cdna clone
Sequence
atgaagagcgtcttgctgctgaccacgctcctcgtgcctgcacacctggtggccgcctggagcaataattatgcggtggactgccctcaacactgtgacagcagtgagtgcaaaagcagcccgcgctgcgagaggacagtgctcgacgactgtggctgctgccgagtgtgcgctgcagggcggggagaaacttgctaccgcacagtctcaggcatggatggcatgaagtgtggcccggggctgaggtgtcagccttctaatggggaggatccttttggtgaagagtttggtatctgcaaagactgtccctacggcaccttcgggatggattgcagagagacctgcaactgccagtcaggcatctgtgacagggggacgggaaaatgcctgaaattccccttcttccaatattcagtaaccaagtcttccaacagatttgtttctctcacggagcatgacatggcatctggagatggcaatattgtgagagaagaagttgtgaaagagaatgctgccgggtctcccgtaatgaggaaatggttaaatccacgctga
Sequence Length
555
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
14,513 Da
NCBI Official Full Name
Homo sapiens endothelial cell-specific molecule 1, mRNA
NCBI Official Synonym Full Names
endothelial cell specific molecule 1
NCBI Official Symbol
ESM1
NCBI Official Synonym Symbols
endocan
NCBI Protein Information
endothelial cell-specific molecule 1
UniProt Protein Name
Endothelial cell-specific molecule 1
UniProt Gene Name
ESM1
UniProt Synonym Gene Names
ESM-1
UniProt Entry Name
ESM1_HUMAN
Similar Products
Product Notes
The ESM1 esm1 (Catalog #AAA116474) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagagcg tcttgctgct gaccacgctc ctcgtgcctg cacacctggt ggccgcctgg agcaataatt atgcggtgga ctgccctcaa cactgtgaca gcagtgagtg caaaagcagc ccgcgctgcg agaggacagt gctcgacgac tgtggctgct gccgagtgtg cgctgcaggg cggggagaaa cttgctaccg cacagtctca ggcatggatg gcatgaagtg tggcccgggg ctgaggtgtc agccttctaa tggggaggat ccttttggtg aagagtttgg tatctgcaaa gactgtccct acggcacctt cgggatggat tgcagagaga cctgcaactg ccagtcaggc atctgtgaca gggggacggg aaaatgcctg aaattcccct tcttccaata ttcagtaacc aagtcttcca acagatttgt ttctctcacg gagcatgaca tggcatctgg agatggcaat attgtgagag aagaagttgt gaaagagaat gctgccgggt ctcccgtaat gaggaaatgg ttaaatccac gctga. It is sometimes possible for the material contained within the vial of "ESM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.