Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

FFAR3 cdna clone

FFAR3 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
FFAR3; FFA3R; GPR41; GPR42
Synonyms
FFAR3; N/A; FFAR3 cDNA Clone; FFAR3 cdna clone
Ordering
Sequence
atggatacaggccccgaccagtcctacttctccggcaatcactggttcgtcttctcggtgtaccttctcactttcctggtggggctccccctcaacctgctggccctggtggtcttcgtgggcaagctgcagcgccgcccggtggccgtggacgtgctcctgctcaacctgaccgcctcggacctgctcctgctgctgttcctgcctttccgcatggtggaggcagccaatggcatgcactggcccctgcccttcatcctctgcccactctctggattcatcttcttcaccaccatctatctcaccgccctcttcctggcagctgtgagcattgaacgcttcctgagtgtggcccacccactgtggtacaagacccggccgaggctggggcaggcaggtctggtgagtgtggcctgctggctgttggcctctgctcactgcagcgtggtctacgtcatagaattctcaggggacatctcccacagccagggcaccaatgggacctgctacctggagttccggaaggaccagctagccatcctcctgcccgtgcggctggagatggctgtggtcctctttgtggtcccgctgatcatcaccagctactgctacagccgcctggtgtggatcctcggcagagggggcagccaccgccggcagaggagggtggcggggctgttggcggccacgctgctcaacttccttgtctgctttgggccctacaacgtgtcccatgtcgtgggctatatctgcggtgaaagcccggcgtggaggatctacgtgacgcttctcagcaccctgaactcctgtgtcgacccctttgtctactacttctcctcctccgggttccaagccgactttcatgagctgctgaggaggttgtgtgggctctggggccagtggcagcaggagagcagcatggagctgaaggagcagaagggaggggaggagcagagagcggaccgaccagctgaaagaaagaccagtgaacactcacagggctgtggaactggtggccaggtggcctgtgctgaaagctag
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,649 Da
NCBI Official Full Name
Homo sapiens free fatty acid receptor 3, mRNA
NCBI Official Synonym Full Names
free fatty acid receptor 3
NCBI Official Symbol
FFAR3
NCBI Official Synonym Symbols
FFA3R; GPR41; GPR42
NCBI Protein Information
free fatty acid receptor 3
UniProt Protein Name
Free fatty acid receptor 3
UniProt Gene Name
FFAR3
UniProt Synonym Gene Names
GPR41
UniProt Entry Name
FFAR3_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The FFAR3 ffar3 (Catalog #AAA116276) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatacag gccccgacca gtcctacttc tccggcaatc actggttcgt cttctcggtg taccttctca ctttcctggt ggggctcccc ctcaacctgc tggccctggt ggtcttcgtg ggcaagctgc agcgccgccc ggtggccgtg gacgtgctcc tgctcaacct gaccgcctcg gacctgctcc tgctgctgtt cctgcctttc cgcatggtgg aggcagccaa tggcatgcac tggcccctgc ccttcatcct ctgcccactc tctggattca tcttcttcac caccatctat ctcaccgccc tcttcctggc agctgtgagc attgaacgct tcctgagtgt ggcccaccca ctgtggtaca agacccggcc gaggctgggg caggcaggtc tggtgagtgt ggcctgctgg ctgttggcct ctgctcactg cagcgtggtc tacgtcatag aattctcagg ggacatctcc cacagccagg gcaccaatgg gacctgctac ctggagttcc ggaaggacca gctagccatc ctcctgcccg tgcggctgga gatggctgtg gtcctctttg tggtcccgct gatcatcacc agctactgct acagccgcct ggtgtggatc ctcggcagag ggggcagcca ccgccggcag aggagggtgg cggggctgtt ggcggccacg ctgctcaact tccttgtctg ctttgggccc tacaacgtgt cccatgtcgt gggctatatc tgcggtgaaa gcccggcgtg gaggatctac gtgacgcttc tcagcaccct gaactcctgt gtcgacccct ttgtctacta cttctcctcc tccgggttcc aagccgactt tcatgagctg ctgaggaggt tgtgtgggct ctggggccag tggcagcagg agagcagcat ggagctgaag gagcagaagg gaggggagga gcagagagcg gaccgaccag ctgaaagaaa gaccagtgaa cactcacagg gctgtggaac tggtggccag gtggcctgtg ctgaaagcta g. It is sometimes possible for the material contained within the vial of "FFAR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.