Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

G6PD cDNA Clone – Homo Sapiens Glucose-6-Phosphate Dehydrogenase, Mrna

G6PD cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
G6PD; G6PD1
Synonyms
G6PD; N/A; G6PD cDNA Clone; G6PD cdna clone
Ordering

Product Overview

Sequence
atggcagagcaggtggccctgagccggacccaggtgtgcgggatcctgcgggaagagcttttccagggcgatgccttccatcagtcggatacacacatattcatcatcatgggtgcatcgggtgacctggccaagaagaagatctaccccaccatctggtggctgttccgggatggccttctgcccgaaaacaccttcatcgtgggctatgcccgttcccgcctcacagtggctgacatccgcaaacagagtgagcccttcttcaaggccaccccagaggagaagctcaagctggaggacttctttgcccgcaactcctatgtggctggccagtacgatgatgcagcctcctaccagcgcctcaacagccacatgaatgccctccacctggggtcacaggccaaccgcctcttctacctggccttgcccccgaccgtctacgaggccgtcaccaagaacattcacgagtcctgcatgagccagataggctggaaccgcatcatcgtggagaagcccttcgggagggacctgcagagctctgaccggctgtccaaccacatctcctccctgttccgtgaggaccagatctaccgcatcgaccactacctgggcaaggagatggtgcagaacctcatggtgctgagatttgccaacaggatcttcggccccatctggaaccgggacaacatcgcctgcgttatcctcaccttcaaggagccctttggcactgagggtcgcgggggctatttcgatgaatttgggatcatccgggacgtgatgcagaaccacctactgcagatgctgtgtctggtggccatggagaagcccgcctccaccaactcagatgacgtccgtgatgagaaggtcaaggtgttgaaatgcatctcagaggtgcaggccaacaatgtggtcctgggccagtacgtggggaaccccgatggagagggcgaggccaccaaagggtacctggacgaccccacggtgccccgcgggtccaccaccgccacttttgcagccgtcgtcctctatgtggagaatgagaggtgggatggggtgcccttcatcctgcgctgcggcaaggccctgaacgagcgcaaggccgaggtgaggctgcagttccatgatgtggccggcgacatcttccaccagcagtgcaagcgcaacgagctggtgatccgcgtgcagcccaacgaggccgtgtacaccaagatgatgaccaagaagccgggcatgttcttcaaccccgaggagtcggagctggacctgacctacggcaacagatacaagaacgtgaagctccctgacgcctatgagcgcctcatcctggacgtcttctgcgggagccagatgcacttcgtgcgcagcgacgagctccgtgaggcctggcgtattttcaccccactgctgcaccagattgagctggagaagcccaagcccatcccctatatttatggcagccgaggccccacggaggcagacgagctgatgaagagagtgggtttccagtatgagggcacctacaagtgggtgaacccccacaagctctga
Sequence Length
1548
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,468 Da
NCBI Official Full Name
Homo sapiens glucose-6-phosphate dehydrogenase, mRNA
NCBI Official Synonym Full Names
glucose-6-phosphate dehydrogenase
NCBI Official Symbol
G6PD
NCBI Official Synonym Symbols
G6PD1
NCBI Protein Information
glucose-6-phosphate 1-dehydrogenase
UniProt Protein Name
Glucose-6-phosphate 1-dehydrogenase
UniProt Gene Name
G6PD
UniProt Synonym Gene Names
G6PD
UniProt Entry Name
G6PD_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Additional Details

Product Notes

The G6PD g6pd (Catalog #AAA116441) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagagc aggtggccct gagccggacc caggtgtgcg ggatcctgcg ggaagagctt ttccagggcg atgccttcca tcagtcggat acacacatat tcatcatcat gggtgcatcg ggtgacctgg ccaagaagaa gatctacccc accatctggt ggctgttccg ggatggcctt ctgcccgaaa acaccttcat cgtgggctat gcccgttccc gcctcacagt ggctgacatc cgcaaacaga gtgagccctt cttcaaggcc accccagagg agaagctcaa gctggaggac ttctttgccc gcaactccta tgtggctggc cagtacgatg atgcagcctc ctaccagcgc ctcaacagcc acatgaatgc cctccacctg gggtcacagg ccaaccgcct cttctacctg gccttgcccc cgaccgtcta cgaggccgtc accaagaaca ttcacgagtc ctgcatgagc cagataggct ggaaccgcat catcgtggag aagcccttcg ggagggacct gcagagctct gaccggctgt ccaaccacat ctcctccctg ttccgtgagg accagatcta ccgcatcgac cactacctgg gcaaggagat ggtgcagaac ctcatggtgc tgagatttgc caacaggatc ttcggcccca tctggaaccg ggacaacatc gcctgcgtta tcctcacctt caaggagccc tttggcactg agggtcgcgg gggctatttc gatgaatttg ggatcatccg ggacgtgatg cagaaccacc tactgcagat gctgtgtctg gtggccatgg agaagcccgc ctccaccaac tcagatgacg tccgtgatga gaaggtcaag gtgttgaaat gcatctcaga ggtgcaggcc aacaatgtgg tcctgggcca gtacgtgggg aaccccgatg gagagggcga ggccaccaaa gggtacctgg acgaccccac ggtgccccgc gggtccacca ccgccacttt tgcagccgtc gtcctctatg tggagaatga gaggtgggat ggggtgccct tcatcctgcg ctgcggcaag gccctgaacg agcgcaaggc cgaggtgagg ctgcagttcc atgatgtggc cggcgacatc ttccaccagc agtgcaagcg caacgagctg gtgatccgcg tgcagcccaa cgaggccgtg tacaccaaga tgatgaccaa gaagccgggc atgttcttca accccgagga gtcggagctg gacctgacct acggcaacag atacaagaac gtgaagctcc ctgacgccta tgagcgcctc atcctggacg tcttctgcgg gagccagatg cacttcgtgc gcagcgacga gctccgtgag gcctggcgta ttttcacccc actgctgcac cagattgagc tggagaagcc caagcccatc ccctatattt atggcagccg aggccccacg gaggcagacg agctgatgaa gagagtgggt ttccagtatg agggcaccta caagtgggtg aacccccaca agctctga. It is sometimes possible for the material contained within the vial of "G6PD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.