Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

GCKR cdna clone

GCKR cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
GCKR; GKRP; FGQTL5
Synonyms
GCKR; N/A; GCKR cDNA Clone; GCKR cdna clone
Ordering
Sequence
atgccaggcacaaaacggtttcaacatgtcattgagaccccggagcctggcaagtgggagttgtctgggtacgaggcagctgtgccaatcacggagaagtcaaacccactgacccaggatctagacaaagcagatgctgagaacattgttcgactgctagggcaatgtgatgctgagatcttccaggaggaggggcaagccctgtccacataccagagactctacagcgaatccattctgaccaccatggtacaggtggctgggaaagttcaggaagtgctgaaggagccagatggggggctggttgtgctgagtggagggggcacctctggccggatggcattcctcatgtcggtgtcctttaatcagctgatgaaaggtctgggacagaaacctctttacacctacctcattgcaggtggtgacaggtctgtggtggcctctagggaggggacagaagatagtgccttgcacgggattgaggaactgaagaaggtggctgccgggaagaagagagtgattgtcattggcatttctgtgggactctctgctccctttgtggcaggccagatggactgctgcatgaacaacacagctgtcttcttgccagtcctggttggcttcaatccagtgagcatggccagaaatgaccccattgaagactggagttcaacattccgacaagtagcagagcggatgcagaaaatgcaggagaaacagaaagcttttgtgctcaatcctgccatcgggcccgagggtctcagcggctcctcccggatgaaaggtggaagtgccaccaagattctgctggaaaccctgttattagcagcccataagactgtggaccagggcattgcagcatctcaaagatgcctcctggaaatcttgcggacatttgagcgagctcatcaggtgacctacagccaaagccccaagattgccaccctgatgaagagtgtcagcaccagtctggagaagaaaggccacgtgtacctggttggctggcagaccctgggcatcattgccatcatggatggagtagagtgcatccacacctttggtgctgatttccgagatgtccgtggctttctcattggtgatcacagtgacatgtttaaccagaaggctgagctcaccaaccagggtccccagttcaccttctcccaggaggacttcctgacttccatccttccctctctcacggaaatcgatactgtggtcttcattttcaccctggatgacaacctcacggaggtgcagactatagtggagcaggtgaaagagaagaccaaccacatccaggccctggcacacagcaccgtgggtcagaccttgccgatccctctgaagaagctctttccctccatcatcagcatcacatggccactgcttttctttgaatatgaagggaacttcatccagaagttccagcgtgagctaagcaccaaatgggtgctgaatacagtgagtacaggtgctcatgtgcttcttggtaagatcctacaaaaccacatgttggaccttcggattagcaactccaagctcttctggcgggcgctggccatgctgcagcggttctctggacagtccaaggctcgatgcatcgagagcctcctccgagcgatccactttccccagccactgtcagatgatattcgggctgctcccatctcctgccatgtccaggttgcacatgagaaggaacaggtgatacccatcgccttgctgagcctcctattccggtgctcgatcactgaggctcaggcacacctggctgcagctccttctgtctgtgaggctgtcaggagtgctcttgctgggccaggtcagaagcgcactgcggaccccctcgagatcctagagcctgacgttcagtga
Sequence Length
1878
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,477 Da
NCBI Official Full Name
Homo sapiens glucokinase (hexokinase 4) regulator, mRNA
NCBI Official Synonym Full Names
glucokinase regulator
NCBI Official Symbol
GCKR
NCBI Official Synonym Symbols
GKRP; FGQTL5
NCBI Protein Information
glucokinase regulatory protein
UniProt Protein Name
Glucokinase regulatory protein
UniProt Gene Name
GCKR
UniProt Synonym Gene Names
GKRP; Glucokinase regulator
UniProt Entry Name
GCKR_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The GCKR gckr (Catalog #AAA116483) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaggca caaaacggtt tcaacatgtc attgagaccc cggagcctgg caagtgggag ttgtctgggt acgaggcagc tgtgccaatc acggagaagt caaacccact gacccaggat ctagacaaag cagatgctga gaacattgtt cgactgctag ggcaatgtga tgctgagatc ttccaggagg aggggcaagc cctgtccaca taccagagac tctacagcga atccattctg accaccatgg tacaggtggc tgggaaagtt caggaagtgc tgaaggagcc agatgggggg ctggttgtgc tgagtggagg gggcacctct ggccggatgg cattcctcat gtcggtgtcc tttaatcagc tgatgaaagg tctgggacag aaacctcttt acacctacct cattgcaggt ggtgacaggt ctgtggtggc ctctagggag gggacagaag atagtgcctt gcacgggatt gaggaactga agaaggtggc tgccgggaag aagagagtga ttgtcattgg catttctgtg ggactctctg ctccctttgt ggcaggccag atggactgct gcatgaacaa cacagctgtc ttcttgccag tcctggttgg cttcaatcca gtgagcatgg ccagaaatga ccccattgaa gactggagtt caacattccg acaagtagca gagcggatgc agaaaatgca ggagaaacag aaagcttttg tgctcaatcc tgccatcggg cccgagggtc tcagcggctc ctcccggatg aaaggtggaa gtgccaccaa gattctgctg gaaaccctgt tattagcagc ccataagact gtggaccagg gcattgcagc atctcaaaga tgcctcctgg aaatcttgcg gacatttgag cgagctcatc aggtgaccta cagccaaagc cccaagattg ccaccctgat gaagagtgtc agcaccagtc tggagaagaa aggccacgtg tacctggttg gctggcagac cctgggcatc attgccatca tggatggagt agagtgcatc cacacctttg gtgctgattt ccgagatgtc cgtggctttc tcattggtga tcacagtgac atgtttaacc agaaggctga gctcaccaac cagggtcccc agttcacctt ctcccaggag gacttcctga cttccatcct tccctctctc acggaaatcg atactgtggt cttcattttc accctggatg acaacctcac ggaggtgcag actatagtgg agcaggtgaa agagaagacc aaccacatcc aggccctggc acacagcacc gtgggtcaga ccttgccgat ccctctgaag aagctctttc cctccatcat cagcatcaca tggccactgc ttttctttga atatgaaggg aacttcatcc agaagttcca gcgtgagcta agcaccaaat gggtgctgaa tacagtgagt acaggtgctc atgtgcttct tggtaagatc ctacaaaacc acatgttgga ccttcggatt agcaactcca agctcttctg gcgggcgctg gccatgctgc agcggttctc tggacagtcc aaggctcgat gcatcgagag cctcctccga gcgatccact ttccccagcc actgtcagat gatattcggg ctgctcccat ctcctgccat gtccaggttg cacatgagaa ggaacaggtg atacccatcg ccttgctgag cctcctattc cggtgctcga tcactgaggc tcaggcacac ctggctgcag ctccttctgt ctgtgaggct gtcaggagtg ctcttgctgg gccaggtcag aagcgcactg cggaccccct cgagatccta gagcctgacg ttcagtga. It is sometimes possible for the material contained within the vial of "GCKR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.