GGPS1 cDNA Clone – Homo Sapiens Geranylgeranyl Diphosphate Synthase 1, Mrna
GGPS1 cDNA Clone
Gene Names
GGPS1; GGPPS; GGPPS1
Synonyms
GGPS1; N/A; GGPS1 cDNA Clone; GGPS1 cdna clone
Product Overview
Sequence
atggagaagactcaagaaacagtccaaagaattcttctagaaccctataaatacttacttcagttaccaggtaaacaagtgagaaccaaactttcacaggcatttaatcattggctgaaagttccagaggacaagctacagattattattgaagtgacagaaatgttgcataatgccagtttactcatcgatgatattgaagacaactcaaaactccgacgtggctttccagtggcccacagcatctatggaatcccatctgtcatcaattctgccaattacgtgtatttccttggcttggagaaagtcttaacccttgatcacccagatgcagtgaagctttttacccgccagcttttggaactccatcagggacaaggcctagatatttactggagggataattacacttgtcccactgaagaagaatataaagctatggtgctgcagaaaacaggtggactgtttggattagcagtaggtctcatgcagttgttctctgattacaaagaagatttaaaaccgctacttaatacacttgggctctttttccaaattagggatgattatgctaatctacactccaaagaatatagtgaaaacaaaagtttttgtgaagatctgacagagggaaagttctcatttcctactattcatgctatttggtcaaggcctgaaagcacccaggtgcagaatatcttgcgccagagaacagaaaacatagatataaaaaaatactgtgtacattatcttgaggatgtaggttcttttgaatacactcgtaatacccttaaagagcttgaagctaaagcctataaacagattgatgcacgtggtgggaaccctgagctagtagccttagtaaaacacttaagtaagatgttcaaagaagaaaatgaataa
Sequence Length
903
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,423 Da
NCBI Official Full Name
Homo sapiens geranylgeranyl diphosphate synthase 1, mRNA
NCBI Official Synonym Full Names
geranylgeranyl diphosphate synthase 1
NCBI Official Symbol
GGPS1
NCBI Official Synonym Symbols
GGPPS; GGPPS1
NCBI Protein Information
geranylgeranyl pyrophosphate synthase
UniProt Protein Name
Geranylgeranyl pyrophosphate synthase
UniProt Gene Name
GGPS1
UniProt Synonym Gene Names
GGPP synthase; GGPPSase
UniProt Entry Name
GGPPS_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The GGPS1 ggps1 (Catalog #AAA116309) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaga ctcaagaaac agtccaaaga attcttctag aaccctataa atacttactt cagttaccag gtaaacaagt gagaaccaaa ctttcacagg catttaatca ttggctgaaa gttccagagg acaagctaca gattattatt gaagtgacag aaatgttgca taatgccagt ttactcatcg atgatattga agacaactca aaactccgac gtggctttcc agtggcccac agcatctatg gaatcccatc tgtcatcaat tctgccaatt acgtgtattt ccttggcttg gagaaagtct taacccttga tcacccagat gcagtgaagc tttttacccg ccagcttttg gaactccatc agggacaagg cctagatatt tactggaggg ataattacac ttgtcccact gaagaagaat ataaagctat ggtgctgcag aaaacaggtg gactgtttgg attagcagta ggtctcatgc agttgttctc tgattacaaa gaagatttaa aaccgctact taatacactt gggctctttt tccaaattag ggatgattat gctaatctac actccaaaga atatagtgaa aacaaaagtt tttgtgaaga tctgacagag ggaaagttct catttcctac tattcatgct atttggtcaa ggcctgaaag cacccaggtg cagaatatct tgcgccagag aacagaaaac atagatataa aaaaatactg tgtacattat cttgaggatg taggttcttt tgaatacact cgtaataccc ttaaagagct tgaagctaaa gcctataaac agattgatgc acgtggtggg aaccctgagc tagtagcctt agtaaaacac ttaagtaaga tgttcaaaga agaaaatgaa taa. It is sometimes possible for the material contained within the vial of "GGPS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.