Sequence
atggcggcggggctggcgcggctcctgttgctcctcgggctctcggccggcgggcccgcgccggcaggtgcagcgaagatgaaggtggtggaggagcccaacgcgtttggggtgaacaacccgttcttgcctcaggccagtcgcctccaggccaagagggatccttcacccgtgtctggacccgtgcatctcttccgactctcgggcaagtgcttcagcctggtggagtccacgtacaagtatgagttctgcccgttccacaacgtgacccagcacgagcagaccttccgctggaacgcctacagtgggatcctcggcatctggcacgagtgggagatcgccaacaacaccttcacgggcatgtggatgagggacggtgacgcctgccgttcccggagccggcagagcaaggtggagctggcgtgtggaaaaagcaaccggctggcccatgtgtccgagccgagcacctgcgtctacgcgctgacgttcgagacccccctcgtctgccacccccacgccttgctagtgtacccaaccctgccagaggccctgcagcggcagtgggaccaggtagagcaggacctggccgatgagctgatcaccccccagggccatgagaagttgctgaggacactttttgaggatgctggctacttaaagaccccagaaaatgaacccacccagctggagggaggtcctgacagcttggggtttgagaccctggaaaactgcaggaaggctcataaagaactctcaaaggagatcaaaaggctgaaaggtttgctcacccagcacggcatcccctacacgaggcccacagaaacttccaacttggagcacttgggccacgagacgcccagagccaagtctccagagcagctgcggggtgacccaggactgcgtgggagtttgtga
Sequence Length
915
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,974 Da
NCBI Official Full Name
Homo sapiens N-acetylglucosamine-1-phosphate transferase, gamma subunit, mRNA
NCBI Official Synonym Full Names
N-acetylglucosamine-1-phosphate transferase gamma subunit
NCBI Official Symbol
GNPTG
NCBI Official Synonym Symbols
RJD9; GNPTAG; LP2537; C16orf27
NCBI Protein Information
N-acetylglucosamine-1-phosphotransferase subunit gamma
UniProt Protein Name
N-acetylglucosamine-1-phosphotransferase subunit gamma
UniProt Gene Name
GNPTG
UniProt Synonym Gene Names
C16orf27; GNPTAG
UniProt Entry Name
GNPTG_HUMAN
Similar Products
Product Notes
The GNPTG gnptg (Catalog #AAA116450) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ggctggcgcg gctcctgttg ctcctcgggc tctcggccgg cgggcccgcg ccggcaggtg cagcgaagat gaaggtggtg gaggagccca acgcgtttgg ggtgaacaac ccgttcttgc ctcaggccag tcgcctccag gccaagaggg atccttcacc cgtgtctgga cccgtgcatc tcttccgact ctcgggcaag tgcttcagcc tggtggagtc cacgtacaag tatgagttct gcccgttcca caacgtgacc cagcacgagc agaccttccg ctggaacgcc tacagtggga tcctcggcat ctggcacgag tgggagatcg ccaacaacac cttcacgggc atgtggatga gggacggtga cgcctgccgt tcccggagcc ggcagagcaa ggtggagctg gcgtgtggaa aaagcaaccg gctggcccat gtgtccgagc cgagcacctg cgtctacgcg ctgacgttcg agacccccct cgtctgccac ccccacgcct tgctagtgta cccaaccctg ccagaggccc tgcagcggca gtgggaccag gtagagcagg acctggccga tgagctgatc accccccagg gccatgagaa gttgctgagg acactttttg aggatgctgg ctacttaaag accccagaaa atgaacccac ccagctggag ggaggtcctg acagcttggg gtttgagacc ctggaaaact gcaggaaggc tcataaagaa ctctcaaagg agatcaaaag gctgaaaggt ttgctcaccc agcacggcat cccctacacg aggcccacag aaacttccaa cttggagcac ttgggccacg agacgcccag agccaagtct ccagagcagc tgcggggtga cccaggactg cgtgggagtt tgtga. It is sometimes possible for the material contained within the vial of "GNPTG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
