GPM6B cdna clone
GPM6B cDNA Clone
Gene Names
GPM6B; M6B
Synonyms
GPM6B; N/A; GPM6B cDNA Clone; GPM6B cdna clone
Sequence
atgaagccagccatggaaactgcagccgaggaaaatactgaacaaagccaagagagaaaagtgaacagcagagctgaaatggaaattggcaggtaccactggatgtacccaggctcaaagaaccaccagtaccatcccgtgccaaccctgggggacagggctagccccttgagcagtccaggctgctttgaatgctgcatcaagtgtctgggaggagtcccctacgcctccctggtggccaccatcctctgcttctccggggtggccttattctgcggctgtgggcatgtggctctcgcaggcaccgtggcgattcttgagcaacacttctccaccaacgccagtgaccatgccttgctgagcgaggtgatacaactgatgcagtatgtcatctatggaattgcgtcctttttcttcttgtatgggatcattctgttggcagaaggcttttacaccacaagtgcagtgaaagaactgcacggtgagtttaaaacaaccgcttgtggccgatgcatcagtggaatgttcgttttcctcacctatgtgcttggagtggcctggctgggtgtgtttggtttctcagcggtgcccgtgtttatgttctacaacatatggtcaacttgtgaagtcatcaagtcaccgcagaccaacgggaccacgggtgtggagcagatctgtgtggatatccgacaatacggtatcattccttggaatgctttccccggaaaaatatgtggctctgccctggagaacatctgcaacacaaacgagttctacatgtcctatcacctgttcattgtggcctgtgcaggagctggtgccaccgtcattgccctgctgatctacatgatggctactacatataactatgcggttttgaagtttaagagtcgggaagattgctgcactaaattctaa
Sequence Length
918
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,220 Da
NCBI Official Full Name
Homo sapiens glycoprotein M6B, mRNA
NCBI Official Synonym Full Names
glycoprotein M6B
NCBI Official Symbol
GPM6B
NCBI Official Synonym Symbols
M6B
NCBI Protein Information
neuronal membrane glycoprotein M6-b
UniProt Protein Name
Neuronal membrane glycoprotein M6-b
UniProt Gene Name
GPM6B
UniProt Synonym Gene Names
M6B; M6b
UniProt Entry Name
GPM6B_HUMAN
Similar Products
Product Notes
The GPM6B gpm6b (Catalog #AAA116374) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccag ccatggaaac tgcagccgag gaaaatactg aacaaagcca agagagaaaa gtgaacagca gagctgaaat ggaaattggc aggtaccact ggatgtaccc aggctcaaag aaccaccagt accatcccgt gccaaccctg ggggacaggg ctagcccctt gagcagtcca ggctgctttg aatgctgcat caagtgtctg ggaggagtcc cctacgcctc cctggtggcc accatcctct gcttctccgg ggtggcctta ttctgcggct gtgggcatgt ggctctcgca ggcaccgtgg cgattcttga gcaacacttc tccaccaacg ccagtgacca tgccttgctg agcgaggtga tacaactgat gcagtatgtc atctatggaa ttgcgtcctt tttcttcttg tatgggatca ttctgttggc agaaggcttt tacaccacaa gtgcagtgaa agaactgcac ggtgagttta aaacaaccgc ttgtggccga tgcatcagtg gaatgttcgt tttcctcacc tatgtgcttg gagtggcctg gctgggtgtg tttggtttct cagcggtgcc cgtgtttatg ttctacaaca tatggtcaac ttgtgaagtc atcaagtcac cgcagaccaa cgggaccacg ggtgtggagc agatctgtgt ggatatccga caatacggta tcattccttg gaatgctttc cccggaaaaa tatgtggctc tgccctggag aacatctgca acacaaacga gttctacatg tcctatcacc tgttcattgt ggcctgtgca ggagctggtg ccaccgtcat tgccctgctg atctacatga tggctactac atataactat gcggttttga agtttaagag tcgggaagat tgctgcacta aattctaa. It is sometimes possible for the material contained within the vial of "GPM6B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.