Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

GPR125 cdna clone

GPR125 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ADGRA3; PGR21; TEM5L; GPR125
Synonyms
GPR125; N/A; GPR125 cDNA Clone; GPR125 cdna clone
Ordering
Sequence
atgccactgaagaggaataactctaaataccctccgcttgaattgccgtctttctacatgactccatctcatcgccaagttgtgtttgaaggagacagccttcctttccagtgcatggcttcatatattgatcaggacatgcaagtgttgtggtatcaggatgggagaatagttgaaaccgatgaatcgcaaggtatttttgttgaaaagaacatgattcacaactgctccttgattgcaagtgccctaaccatttctaatattcaggctggatctactggaaattggggctgtcatgtccagaccaaacgtgggaataatacgaggactgtggatattgtggtattagagagttctgcacagtactgtccgccagagagggtggtaaacaacaaaggtgacttcagatggcccagaacattggcaggcattactgcatatctgcagtgtacgcggaacacccatggcagtgggatatatcccggaaacccacaggatgagagaaaagcttggcgcagatgtgatagaggtggcttttgggcagatgatgattattctcgctgtcagtatgcaaatgatgtcactagagttctttatatgtttaatcagatgcccctcaatcttaccaatgccgtggcaacagctcgacagttactggcttacactgtggaagcagccaacttttctgacaaaatggatgttatatttgtggcagaaatgattgaaaaatttggaagatttaccaaggaggaaaaatcaaaagagctaggtgacgtgatggttgacattgcaagtaacatcatgttggctgatgaacgtgtcctgtggctggcgcagagggaagctaaagcctgcagtaggattgtgcagtgtcttcagcgcattgctacctaccggctagccggtggagctcacgtttattcaacatatccacccaatattgctctggaagcttatgtcatcaagtctactggcttcacggggatgacctgtaccgtgttccagaaagtggcagcctctgatcgtacaggactttcggattatgggaggcgggatccagagggaaacctggataagcagctgagctttaagtgcaatgtttcaaatacattttcgagtctggcactaaaggggaaattccggtga
Sequence Length
1146
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,973 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 125, mRNA
NCBI Official Synonym Full Names
adhesion G protein-coupled receptor A3
NCBI Official Symbol
ADGRA3
NCBI Official Synonym Symbols
PGR21; TEM5L; GPR125
NCBI Protein Information
adhesion G protein-coupled receptor A3
UniProt Protein Name
Adhesion G protein-coupled receptor A3
UniProt Gene Name
ADGRA3
UniProt Entry Name
AGRA3_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The GPR125 adgra3 (Catalog #AAA116296) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccactga agaggaataa ctctaaatac cctccgcttg aattgccgtc tttctacatg actccatctc atcgccaagt tgtgtttgaa ggagacagcc ttcctttcca gtgcatggct tcatatattg atcaggacat gcaagtgttg tggtatcagg atgggagaat agttgaaacc gatgaatcgc aaggtatttt tgttgaaaag aacatgattc acaactgctc cttgattgca agtgccctaa ccatttctaa tattcaggct ggatctactg gaaattgggg ctgtcatgtc cagaccaaac gtgggaataa tacgaggact gtggatattg tggtattaga gagttctgca cagtactgtc cgccagagag ggtggtaaac aacaaaggtg acttcagatg gcccagaaca ttggcaggca ttactgcata tctgcagtgt acgcggaaca cccatggcag tgggatatat cccggaaacc cacaggatga gagaaaagct tggcgcagat gtgatagagg tggcttttgg gcagatgatg attattctcg ctgtcagtat gcaaatgatg tcactagagt tctttatatg tttaatcaga tgcccctcaa tcttaccaat gccgtggcaa cagctcgaca gttactggct tacactgtgg aagcagccaa cttttctgac aaaatggatg ttatatttgt ggcagaaatg attgaaaaat ttggaagatt taccaaggag gaaaaatcaa aagagctagg tgacgtgatg gttgacattg caagtaacat catgttggct gatgaacgtg tcctgtggct ggcgcagagg gaagctaaag cctgcagtag gattgtgcag tgtcttcagc gcattgctac ctaccggcta gccggtggag ctcacgttta ttcaacatat ccacccaata ttgctctgga agcttatgtc atcaagtcta ctggcttcac ggggatgacc tgtaccgtgt tccagaaagt ggcagcctct gatcgtacag gactttcgga ttatgggagg cgggatccag agggaaacct ggataagcag ctgagcttta agtgcaatgt ttcaaataca ttttcgagtc tggcactaaa ggggaaattc cggtga. It is sometimes possible for the material contained within the vial of "GPR125, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.