Sequence
atgtcggtgaaggagggcgcacagcgcaagtgggcagcgctgaaggagaagctggggccacaggattcggaccccacggaggccaacctggagagcgcggaccctgagctgtgcatccggctgctccagatgccctctgtggtcaactactccggcctgcgcaagcgcctggagggcagcgacggcggctggatggtgcagttcctggagcagagcggcctggacctgctgctggaggcgctggcgcggctgtcgggccgcggcgttgcacgtatctccgacgccctgctgcagctcacctgcgtcagctgcgtgcgcgccgtcatgaactcgcggcagggcatcgagtacatcctcagcaaccagggctacgtgcgccagctctcccaggccctggacacatccaacgtgatggtgaagaagcaggtgtttgagctactggctgccctgtgcatctactctcccgagggccacgtgctgaccctggacgccctggaccactacaagacggtgtgcagccagcagtaccgcttcagcattgtcatgaacgagctctccggcagcgacaacgtgccctacgtggtcaccctgcttagcgtgatcaacgccgtcatcttgggccccgaggacctgcgcgcgcgcacccagctgcggaacgagtttatcgggctgcagctgctggacgtcctggctcgcctgcggtga
Sequence Length
705
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,954 Da
NCBI Official Full Name
Homo sapiens inverted formin, FH2 and WH2 domain containing, mRNA
NCBI Official Synonym Full Names
inverted formin, FH2 and WH2 domain containing
NCBI Official Symbol
INF2
NCBI Official Synonym Symbols
FSGS5; CMTDIE; pp9484; C14orf151; C14orf173
NCBI Protein Information
inverted formin-2
UniProt Protein Name
Inverted formin-2
UniProt Gene Name
INF2
UniProt Synonym Gene Names
C14orf151; C14orf173
UniProt Entry Name
INF2_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The INF2 inf2 (Catalog #AAA116228) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtga aggagggcgc acagcgcaag tgggcagcgc tgaaggagaa gctggggcca caggattcgg accccacgga ggccaacctg gagagcgcgg accctgagct gtgcatccgg ctgctccaga tgccctctgt ggtcaactac tccggcctgc gcaagcgcct ggagggcagc gacggcggct ggatggtgca gttcctggag cagagcggcc tggacctgct gctggaggcg ctggcgcggc tgtcgggccg cggcgttgca cgtatctccg acgccctgct gcagctcacc tgcgtcagct gcgtgcgcgc cgtcatgaac tcgcggcagg gcatcgagta catcctcagc aaccagggct acgtgcgcca gctctcccag gccctggaca catccaacgt gatggtgaag aagcaggtgt ttgagctact ggctgccctg tgcatctact ctcccgaggg ccacgtgctg accctggacg ccctggacca ctacaagacg gtgtgcagcc agcagtaccg cttcagcatt gtcatgaacg agctctccgg cagcgacaac gtgccctacg tggtcaccct gcttagcgtg atcaacgccg tcatcttggg ccccgaggac ctgcgcgcgc gcacccagct gcggaacgag tttatcgggc tgcagctgct ggacgtcctg gctcgcctgc ggtga. It is sometimes possible for the material contained within the vial of "INF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
