Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

KLK10 cdna clone

KLK10 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
KLK10; NES1; PRSSL1
Synonyms
KLK10; N/A; KLK10 cDNA Clone; KLK10 cdna clone
Ordering
Sequence
atgagagctccgcacctccacctctccgccgcctctggcgcccgggctctggcgaagctgctgccgctgctgatggcgcaactctgggccgcagaggcggcgctgctcccccaaaacgacacgcgcttggaccccgaagcctatggcgccccgtgcgcgcgcggctcgcagccctggcaggtctcgctcttcaacggcctctcgttccactgcgcgggtgtcctggtggaccagagttgggtgctgacggccgcgcactgcggaaacaagccactgtgggctcgagtaggggatgaccacctgctgcttcttcagggcgagcagctccgccggacgactcgctctgttgtccatcccaagtaccaccagggctcaggccccatcctgccaaggcgaacggatgagcacgatctcatgttgctaaagctggccaggcccgtagtgccggggccccgcgtccgggccctgcagcttccctaccgctgtgctcagcccggagaccagtgccaggttgctggctggggcaccacggccgcccggagagtgaagtacaacaagggcctgacctgctccagcatcactatcctgagccctaaagagtgtgaggtcttctaccctggcgtggtcaccaacaacatgatatgtgctggactggaccggggccaggacccttgccagagtgactctggaggccccctggtctgtgacgagaccctccaaggcatcctctcgtggggtgtttacccctgtggctctgcccagcatccagctgtctacacccagatctgcaaatacatgtcctggatcaataaagtcatacgctccaactga
Sequence Length
831
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,170 Da
NCBI Official Full Name
Homo sapiens kallikrein-related peptidase 10, mRNA
NCBI Official Synonym Full Names
kallikrein related peptidase 10
NCBI Official Symbol
KLK10
NCBI Official Synonym Symbols
NES1; PRSSL1
NCBI Protein Information
kallikrein-10
UniProt Protein Name
Kallikrein-10
UniProt Gene Name
KLK10
UniProt Synonym Gene Names
NES1; PRSSL1
UniProt Entry Name
KLK10_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The KLK10 klk10 (Catalog #AAA116347) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagagctc cgcacctcca cctctccgcc gcctctggcg cccgggctct ggcgaagctg ctgccgctgc tgatggcgca actctgggcc gcagaggcgg cgctgctccc ccaaaacgac acgcgcttgg accccgaagc ctatggcgcc ccgtgcgcgc gcggctcgca gccctggcag gtctcgctct tcaacggcct ctcgttccac tgcgcgggtg tcctggtgga ccagagttgg gtgctgacgg ccgcgcactg cggaaacaag ccactgtggg ctcgagtagg ggatgaccac ctgctgcttc ttcagggcga gcagctccgc cggacgactc gctctgttgt ccatcccaag taccaccagg gctcaggccc catcctgcca aggcgaacgg atgagcacga tctcatgttg ctaaagctgg ccaggcccgt agtgccgggg ccccgcgtcc gggccctgca gcttccctac cgctgtgctc agcccggaga ccagtgccag gttgctggct ggggcaccac ggccgcccgg agagtgaagt acaacaaggg cctgacctgc tccagcatca ctatcctgag ccctaaagag tgtgaggtct tctaccctgg cgtggtcacc aacaacatga tatgtgctgg actggaccgg ggccaggacc cttgccagag tgactctgga ggccccctgg tctgtgacga gaccctccaa ggcatcctct cgtggggtgt ttacccctgt ggctctgccc agcatccagc tgtctacacc cagatctgca aatacatgtc ctggatcaat aaagtcatac gctccaactg a. It is sometimes possible for the material contained within the vial of "KLK10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.