LAMP2 cdna clone
LAMP2 cDNA Clone
Gene Names
LAMP2; LAMPB; CD107b; LAMP-2; LGP110
Synonyms
LAMP2; N/A; LAMP2 cDNA Clone; LAMP2 cdna clone
Sequence
atggtgtgcttccgcctcttcccggttccgggctcagggctcgttctggtctgcctagtcctgggagctgtgcggtcttatgcattggaacttaatttgacagattcagaaaatgccacttgcctttatgcaaaatggcagatgaatttcacagttcgctatgaaactacaaataaaacttataaaactgtaaccatttcagaccatggcactgtgacatataatggaagcatttgtggggatgatcagaatggtcccaaaatagcagtgcagttcggacctggcttttcctggattgcgaattttaccaaggcagcatctacttattcaattgacagcgtctcattttcctacaacactggtgataacacaacatttcctgatgctgaagataaaggaattcttactgttgatgaacttttggccatcagaattccattgaatgacctttttagatgcaatagtttatcaactttggaaaagaatgatgttgtccaacactactgggatgttcttgtacaagcttttgtccaaaatggcacagtgagcacaaatgagttcctgtgtgataaagacaaaacttcaacagtggcacccaccatacacaccactgtgccatctcctactacaacacctactccaaaggaaaaaccagaagctggaacctattcagttaataatggcaatgatacttgtctgctggctaccatggggctgcagctgaacatcactcaggataaggttgcttcagttattaacatcaaccccaatacaactcactccacaggcagctgccgttctcacactgctctacttagactcaatagcagcaccattaagtatctagactttgtctttgctgtgaaaaatgaaaaccgattttatctgaaggaagtgaacatcagcatgtatttggttaatggctccgttttcagcattgcaaataacaatctcagctactgggatgcccccctgggaagttcttatatgtgcaacaaagagcagactgtttcagtgtctggagcatttcagataaatacctttgatctaagggttcagcctttcaatgtgacacaaggaaagtattctacagcccaagagtgttcgctggatgatgacaccattctaatcccaattatagttggtgctggtctttcaggcttgattatcgttatagtgattgcttacgtaattggcagaagaaaaagttatgctggatatcagactctgtaa
Sequence Length
1233
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,170 Da
NCBI Official Full Name
Homo sapiens lysosomal-associated membrane protein 2, mRNA
NCBI Official Synonym Full Names
lysosomal associated membrane protein 2
NCBI Official Symbol
LAMP2
NCBI Official Synonym Symbols
LAMPB; CD107b; LAMP-2; LGP110
NCBI Protein Information
lysosome-associated membrane glycoprotein 2
UniProt Protein Name
Lysosome-associated membrane glycoprotein 2
UniProt Gene Name
LAMP2
UniProt Synonym Gene Names
LAMP-2; Lysosome-associated membrane protein 2
UniProt Entry Name
LAMP2_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The LAMP2 lamp2 (Catalog #AAA116412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtgct tccgcctctt cccggttccg ggctcagggc tcgttctggt ctgcctagtc ctgggagctg tgcggtctta tgcattggaa cttaatttga cagattcaga aaatgccact tgcctttatg caaaatggca gatgaatttc acagttcgct atgaaactac aaataaaact tataaaactg taaccatttc agaccatggc actgtgacat ataatggaag catttgtggg gatgatcaga atggtcccaa aatagcagtg cagttcggac ctggcttttc ctggattgcg aattttacca aggcagcatc tacttattca attgacagcg tctcattttc ctacaacact ggtgataaca caacatttcc tgatgctgaa gataaaggaa ttcttactgt tgatgaactt ttggccatca gaattccatt gaatgacctt tttagatgca atagtttatc aactttggaa aagaatgatg ttgtccaaca ctactgggat gttcttgtac aagcttttgt ccaaaatggc acagtgagca caaatgagtt cctgtgtgat aaagacaaaa cttcaacagt ggcacccacc atacacacca ctgtgccatc tcctactaca acacctactc caaaggaaaa accagaagct ggaacctatt cagttaataa tggcaatgat acttgtctgc tggctaccat ggggctgcag ctgaacatca ctcaggataa ggttgcttca gttattaaca tcaaccccaa tacaactcac tccacaggca gctgccgttc tcacactgct ctacttagac tcaatagcag caccattaag tatctagact ttgtctttgc tgtgaaaaat gaaaaccgat tttatctgaa ggaagtgaac atcagcatgt atttggttaa tggctccgtt ttcagcattg caaataacaa tctcagctac tgggatgccc ccctgggaag ttcttatatg tgcaacaaag agcagactgt ttcagtgtct ggagcatttc agataaatac ctttgatcta agggttcagc ctttcaatgt gacacaagga aagtattcta cagcccaaga gtgttcgctg gatgatgaca ccattctaat cccaattata gttggtgctg gtctttcagg cttgattatc gttatagtga ttgcttacgt aattggcaga agaaaaagtt atgctggata tcagactctg taa. It is sometimes possible for the material contained within the vial of "LAMP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.