Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

LARS2 cdna clone

LARS2 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
LARS2; HLASA; LEURS; PRLTS4; mtLeuRS
Synonyms
LARS2; N/A; LARS2 cDNA Clone; LARS2 cdna clone
Ordering
Sequence
atggcttctgtttggcagagattgggtttttatgcctctcttctgaaaagacagctaaatggtgggccagatgtcatcaagtgggaaaggagagtaattcccggatgtaccagaagcatctacagtgccacgggaaagtggacaaaagagtatacattgcagacaagaaaggatgttgagaaatggtggcatcaacgaataaaagaacaggcctccaaaatttcagaagctgataaatcgaagccaaaattttacgtgctttccatgttcccttatccttctggtaagctgcacatgggccatgtgcgtgtctacaccatcagcgacaccatagcacggttccagaagatgagagggatgcaggtcatcaaccccatgggatgggatgcttttggattgcctgctgaaaatgccgcagtcgagaggaatctacatccacaaagttggacacaaagtaatattaaacacatgaggaaacagcttgatcgtctgggcctgtgtttcagctgggatagggaaataactacgtgtttgccagattactacaagtggactcagtatctctttattaaactgtatgaggctgggctggcctatcaaaaggaggccctggttaactgggacccagtggatcaaacagtgcttgccaatgagcaggtggatgaacatggctgttcatggcgttctggagcaaaggtggaacagaagtacctcagacaatggtttattaagacaaccgcttatgcaaaggccatgcaggacgcgttggcagaccttccagaatggtatggaataaaaggcatgcaagcccactggattggggactgtgtgggctgccacctggacttcacattaaaggttcatgggcaagccacgggcgaaaagctgactgcctatacggccacccctgaagccatttatggcacctcccacgtggccatctcgcccagccacagactcctacatgggcacagctctctgaaggaagccttgaggatggcccttgtccctggcaaagattgcctcacgcctgtaatggctgtgaacatgctcacccagcaggaggtccctgtcgttattttggccaaagctgacttggaaggctctctggattcaaaaataggaattcccagtactagctcagaggacaccatcttagcccaaaccctgggcctggcctactctgaagtcattgaaactttgccagatggcacagagagactgagcagctctgctgagttcacaggtatgacccggcaggatgcttttctagccctgactcagaaagcccgggggaagagagtgggtggagacgtgacaagtgataaactgaaagactggctgatttcacggcagcggtactggggcacaccaatccccattgtccactgcccagtctgtggccccacacctgtgcccctggaggacttgcctgtgaccctgcccaacatcgcatctttcactggcaagggaggccccccactggccatggcttcagagtgggtgaactgctcctgcccaaggtgcaagggagcagccaagagagagacagacacgatggatacctttgttgattctgcttggtactacttcagatacactgaccctcataatccacacagcccttttaacacagcagtggccgattactggatgcctgtggatttgtacattggagggaaagaacatgccgtcatgcacttgttctatgcaagattctttagtcatttttgccatgatcaaaaaatggttaaacatagggagccttttcataagctgctggcccaaggccttatcaaggggcagacattccgcctaccatctggacagtatctacagagagaggaagtggatctcacaggttccgttcctgttcatgcaaaaacgaaagagaagttagaggtgacgtgggagaagatgagtaagtccaaacacaacggggtggacccagaggaagttgtggagcagtatgggatcgacacgattcggctctacatcctttttgctgcccctcctgagaaggatatcttgtgggatgtgaaaactgatgctctccctggggtgctgagatggcaacaacgactgtggaccttgacaactcggtttattgaggccagggcttctgggaagtctccccagcctcagctgctgagtaacaaggagaaagccgaggccaggaagctctgggagtacaagaactccgtcatctctcaggtgaccacccatttcacagaggacttctcactgaattctgcaatttctcagctgatgggactcagcaatgccctctcgcaagcctctcagagcgtcattctccacagccccgagtttgaggatgctttgtgtgccctgatggtgatggctgctccactggcccctcatgtaacctcagagatctgggcaggcctggcgctggtgccgaggaagctctgtgcccactacacttgggatgccagtgtgctgctccaggcatggcctgctgtggacccggagttcctgcagcagcctgaggttgtccagatggcagttctgatcaacaataaagcttgtggcaaaattcctgtgccccaacaagttgcccgggaccaggacaaagtccacgaatttgttcttcaaagcgagctgggtgtcaggcttttgcaaggacgaagcatcaagaagtccttcctttccccgagaactgccctcatcaacttcctggtgcaagattga
Sequence Length
2712
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
101,976 Da
NCBI Official Full Name
Homo sapiens leucyl-tRNA synthetase 2, mitochondrial, mRNA
NCBI Official Synonym Full Names
leucyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
LARS2
NCBI Official Synonym Symbols
HLASA; LEURS; PRLTS4; mtLeuRS
NCBI Protein Information
probable leucine--tRNA ligase, mitochondrial
UniProt Protein Name
Probable leucine--tRNA ligase, mitochondrial
UniProt Gene Name
LARS2
UniProt Synonym Gene Names
KIAA0028; LeuRS
UniProt Entry Name
SYLM_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The LARS2 lars2 (Catalog #AAA116470) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttctg tttggcagag attgggtttt tatgcctctc ttctgaaaag acagctaaat ggtgggccag atgtcatcaa gtgggaaagg agagtaattc ccggatgtac cagaagcatc tacagtgcca cgggaaagtg gacaaaagag tatacattgc agacaagaaa ggatgttgag aaatggtggc atcaacgaat aaaagaacag gcctccaaaa tttcagaagc tgataaatcg aagccaaaat tttacgtgct ttccatgttc ccttatcctt ctggtaagct gcacatgggc catgtgcgtg tctacaccat cagcgacacc atagcacggt tccagaagat gagagggatg caggtcatca accccatggg atgggatgct tttggattgc ctgctgaaaa tgccgcagtc gagaggaatc tacatccaca aagttggaca caaagtaata ttaaacacat gaggaaacag cttgatcgtc tgggcctgtg tttcagctgg gatagggaaa taactacgtg tttgccagat tactacaagt ggactcagta tctctttatt aaactgtatg aggctgggct ggcctatcaa aaggaggccc tggttaactg ggacccagtg gatcaaacag tgcttgccaa tgagcaggtg gatgaacatg gctgttcatg gcgttctgga gcaaaggtgg aacagaagta cctcagacaa tggtttatta agacaaccgc ttatgcaaag gccatgcagg acgcgttggc agaccttcca gaatggtatg gaataaaagg catgcaagcc cactggattg gggactgtgt gggctgccac ctggacttca cattaaaggt tcatgggcaa gccacgggcg aaaagctgac tgcctatacg gccacccctg aagccattta tggcacctcc cacgtggcca tctcgcccag ccacagactc ctacatgggc acagctctct gaaggaagcc ttgaggatgg cccttgtccc tggcaaagat tgcctcacgc ctgtaatggc tgtgaacatg ctcacccagc aggaggtccc tgtcgttatt ttggccaaag ctgacttgga aggctctctg gattcaaaaa taggaattcc cagtactagc tcagaggaca ccatcttagc ccaaaccctg ggcctggcct actctgaagt cattgaaact ttgccagatg gcacagagag actgagcagc tctgctgagt tcacaggtat gacccggcag gatgcttttc tagccctgac tcagaaagcc cgggggaaga gagtgggtgg agacgtgaca agtgataaac tgaaagactg gctgatttca cggcagcggt actggggcac accaatcccc attgtccact gcccagtctg tggccccaca cctgtgcccc tggaggactt gcctgtgacc ctgcccaaca tcgcatcttt cactggcaag ggaggccccc cactggccat ggcttcagag tgggtgaact gctcctgccc aaggtgcaag ggagcagcca agagagagac agacacgatg gatacctttg ttgattctgc ttggtactac ttcagataca ctgaccctca taatccacac agccctttta acacagcagt ggccgattac tggatgcctg tggatttgta cattggaggg aaagaacatg ccgtcatgca cttgttctat gcaagattct ttagtcattt ttgccatgat caaaaaatgg ttaaacatag ggagcctttt cataagctgc tggcccaagg ccttatcaag gggcagacat tccgcctacc atctggacag tatctacaga gagaggaagt ggatctcaca ggttccgttc ctgttcatgc aaaaacgaaa gagaagttag aggtgacgtg ggagaagatg agtaagtcca aacacaacgg ggtggaccca gaggaagttg tggagcagta tgggatcgac acgattcggc tctacatcct ttttgctgcc cctcctgaga aggatatctt gtgggatgtg aaaactgatg ctctccctgg ggtgctgaga tggcaacaac gactgtggac cttgacaact cggtttattg aggccagggc ttctgggaag tctccccagc ctcagctgct gagtaacaag gagaaagccg aggccaggaa gctctgggag tacaagaact ccgtcatctc tcaggtgacc acccatttca cagaggactt ctcactgaat tctgcaattt ctcagctgat gggactcagc aatgccctct cgcaagcctc tcagagcgtc attctccaca gccccgagtt tgaggatgct ttgtgtgccc tgatggtgat ggctgctcca ctggcccctc atgtaacctc agagatctgg gcaggcctgg cgctggtgcc gaggaagctc tgtgcccact acacttggga tgccagtgtg ctgctccagg catggcctgc tgtggacccg gagttcctgc agcagcctga ggttgtccag atggcagttc tgatcaacaa taaagcttgt ggcaaaattc ctgtgcccca acaagttgcc cgggaccagg acaaagtcca cgaatttgtt cttcaaagcg agctgggtgt caggcttttg caaggacgaa gcatcaagaa gtccttcctt tccccgagaa ctgccctcat caacttcctg gtgcaagatt ga. It is sometimes possible for the material contained within the vial of "LARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.