Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

LGMN cDNA Clone – Homo Sapiens Legumain, Mrna

LGMN cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
LGMN; AEP; LGMN1; PRSC1
Synonyms
LGMN; N/A; LGMN cDNA Clone; LGMN cdna clone
Ordering

Product Overview

Sequence
atggtttggaaagtagctgtattcctcagtgtggccctgggcattggtgccattcctatagatgatcctgaagatggaggcaagcactgggtggtgatcgtggcaggttcaaatggctggtataattataggcaccaggcagacgcgtgccatgcctaccagatcattcaccgcaatgggattcctgacgaacagatcgttgtgatgatgtacgatgacattgcttactctgaagacaatcccactccaggaattgtgatcaacaggcccaatggcacagatgtctatcagggagtcccgaaggactacactggagaggatgttaccccacaaaatttccttgctgtgttgagaggcgatgcagaagcagtgaagggcataggatccggcaaagtcctgaagagtggcccccaggatcacgtgttcatttacttcactgaccatggatctactggaatactggtttttcccaatgaagatcttcatgtaaaggacctgaatgagaccatccattacatgtacaaacacaaaatgtaccgaaagatggtgttctacattgaagcctgtgagtctgggtccatgatgaaccacctgccggataacatcaatgtttatgcaactactgctgccaaccccagagagtcgtcctacgcctgttactatgatgagaagaggtccacgtacctgggggactggtacagcgtcaactggatggaagactcggacgtggaagatctgactaaagagaccctgcacaagcagtaccacctggtaaaatcgcacaccaacaccagccacgtcatgcagtatggaaacaaaacaatctccaccatgaaagtgatgcagtttcagggtatgaaacgcaaagccagttctcccgtccccctacctccagtcacacaccttgacctcacccccagccctgatgtgcctctcaccatcatgaaaaggaaactgatgaacaccaatgatctggaggagtccaggcagctcacggaggagatccagcggcatctggatgccaggcacctcattgagaagtcagtgcgtaagatcgtctccttgctggcagcgtccgaggctgaggtggagcagctcctgtccgagagagccccgctcacggggcacagctgctacccagaggccctgctgcacttccggacccactgcttcaactggcactcccccacgtacgagtatgcgttgagacatttgtacgtgctggtcaacctttgtgagaagccgtatccacttcacaggataaaattgtccatggaccacgtgtgccttggtcactactga
Sequence Length
1302
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,008 Da
NCBI Official Full Name
Homo sapiens legumain, mRNA
NCBI Official Synonym Full Names
legumain
NCBI Official Symbol
LGMN
NCBI Official Synonym Symbols
AEP; LGMN1; PRSC1
NCBI Protein Information
legumain
UniProt Protein Name
Legumain
UniProt Gene Name
LGMN
UniProt Synonym Gene Names
PRSC1
UniProt Entry Name
LGMN_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Additional Details

Product Notes

The LGMN lgmn (Catalog #AAA116348) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtttgga aagtagctgt attcctcagt gtggccctgg gcattggtgc cattcctata gatgatcctg aagatggagg caagcactgg gtggtgatcg tggcaggttc aaatggctgg tataattata ggcaccaggc agacgcgtgc catgcctacc agatcattca ccgcaatggg attcctgacg aacagatcgt tgtgatgatg tacgatgaca ttgcttactc tgaagacaat cccactccag gaattgtgat caacaggccc aatggcacag atgtctatca gggagtcccg aaggactaca ctggagagga tgttacccca caaaatttcc ttgctgtgtt gagaggcgat gcagaagcag tgaagggcat aggatccggc aaagtcctga agagtggccc ccaggatcac gtgttcattt acttcactga ccatggatct actggaatac tggtttttcc caatgaagat cttcatgtaa aggacctgaa tgagaccatc cattacatgt acaaacacaa aatgtaccga aagatggtgt tctacattga agcctgtgag tctgggtcca tgatgaacca cctgccggat aacatcaatg tttatgcaac tactgctgcc aaccccagag agtcgtccta cgcctgttac tatgatgaga agaggtccac gtacctgggg gactggtaca gcgtcaactg gatggaagac tcggacgtgg aagatctgac taaagagacc ctgcacaagc agtaccacct ggtaaaatcg cacaccaaca ccagccacgt catgcagtat ggaaacaaaa caatctccac catgaaagtg atgcagtttc agggtatgaa acgcaaagcc agttctcccg tccccctacc tccagtcaca caccttgacc tcacccccag ccctgatgtg cctctcacca tcatgaaaag gaaactgatg aacaccaatg atctggagga gtccaggcag ctcacggagg agatccagcg gcatctggat gccaggcacc tcattgagaa gtcagtgcgt aagatcgtct ccttgctggc agcgtccgag gctgaggtgg agcagctcct gtccgagaga gccccgctca cggggcacag ctgctaccca gaggccctgc tgcacttccg gacccactgc ttcaactggc actcccccac gtacgagtat gcgttgagac atttgtacgt gctggtcaac ctttgtgaga agccgtatcc acttcacagg ataaaattgt ccatggacca cgtgtgcctt ggtcactact ga. It is sometimes possible for the material contained within the vial of "LGMN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.