Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

LPGAT1 cdna clone

LPGAT1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
LPGAT1; NET8; FAM34A; FAM34A1
Synonyms
LPGAT1; N/A; LPGAT1 cDNA Clone; LPGAT1 cdna clone
Ordering
Sequence
atggctataactttggaagaagctccgtggctgggctggctcttggtgaaagcactgatgaggtttgccttcatggtcgtcaacaacctggttgctattccatcctacatctgctatgtaattatacttcagccccttcgagtgctggacagtaagcggttctggtatatcgaaggaatcatgtataaatggcttttaggaatggtagcttcctggggatggtatgctggatatacagtgatggaatggggagaagatattaaagcagtttcaaaagatgaagcagtgatgttggtgaatcatcaggcaacaggagatgtgtgcacactgatgatgtgcctccaggacaaaggactggttgttgctcagatgatgtggttgatggatcatatttttaagtacacaaactttggaattgtttctctagttcatggagacttctttataagacagggaagatcttatcgtgaccaacagctgctgcttctcaagaagcacttagaaaataattacaggagcagagatcgaaaatggattgttttgtttccagaagggggcttcctcaggaagaggcgagaaacaagtcaggcatttgccaagaaaaataacttgccatttcttacaaatgttactctgccaaggtctggggcaacaaaaattattttgaatgcacttgtagcacaacagaaaaatggaagtccagcaggaggagatgctaaagaattagacagcaaatcaaaaggcctccagtggataatagatacaacgatagcttatcccaaagctgaacctatagatattcaaacctggatccttggatacaggaaaccaacagtcacacatgtacattacaggatctttccaattaaagatgtacccctggagactgatgaccttaccacttggctctatcagcggtttgttgaaaaagaagacctcttatcacatttttatgaaacaggagcttttccaccttccaagggccataaggaagctgtttccagggagatgaccctcagcaacttgtggatatttctcatacagtcttttgcatttttgtcaggctatatgtggtacaacatcattcagtatttttaccattgcctgttttag
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,089 Da
NCBI Official Full Name
Homo sapiens lysophosphatidylglycerol acyltransferase 1, mRNA
NCBI Official Synonym Full Names
lysophosphatidylglycerol acyltransferase 1
NCBI Official Symbol
LPGAT1
NCBI Official Synonym Symbols
NET8; FAM34A; FAM34A1
NCBI Protein Information
acyl-CoA:lysophosphatidylglycerol acyltransferase 1
UniProt Protein Name
Acyl-CoA:lysophosphatidylglycerol acyltransferase 1
UniProt Gene Name
LPGAT1
UniProt Synonym Gene Names
FAM34A; KIAA0205
UniProt Entry Name
LGAT1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The LPGAT1 lpgat1 (Catalog #AAA116415) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctataa ctttggaaga agctccgtgg ctgggctggc tcttggtgaa agcactgatg aggtttgcct tcatggtcgt caacaacctg gttgctattc catcctacat ctgctatgta attatacttc agccccttcg agtgctggac agtaagcggt tctggtatat cgaaggaatc atgtataaat ggcttttagg aatggtagct tcctggggat ggtatgctgg atatacagtg atggaatggg gagaagatat taaagcagtt tcaaaagatg aagcagtgat gttggtgaat catcaggcaa caggagatgt gtgcacactg atgatgtgcc tccaggacaa aggactggtt gttgctcaga tgatgtggtt gatggatcat atttttaagt acacaaactt tggaattgtt tctctagttc atggagactt ctttataaga cagggaagat cttatcgtga ccaacagctg ctgcttctca agaagcactt agaaaataat tacaggagca gagatcgaaa atggattgtt ttgtttccag aagggggctt cctcaggaag aggcgagaaa caagtcaggc atttgccaag aaaaataact tgccatttct tacaaatgtt actctgccaa ggtctggggc aacaaaaatt attttgaatg cacttgtagc acaacagaaa aatggaagtc cagcaggagg agatgctaaa gaattagaca gcaaatcaaa aggcctccag tggataatag atacaacgat agcttatccc aaagctgaac ctatagatat tcaaacctgg atccttggat acaggaaacc aacagtcaca catgtacatt acaggatctt tccaattaaa gatgtacccc tggagactga tgaccttacc acttggctct atcagcggtt tgttgaaaaa gaagacctct tatcacattt ttatgaaaca ggagcttttc caccttccaa gggccataag gaagctgttt ccagggagat gaccctcagc aacttgtgga tatttctcat acagtctttt gcatttttgt caggctatat gtggtacaac atcattcagt atttttacca ttgcctgttt tag. It is sometimes possible for the material contained within the vial of "LPGAT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.