MAL cdna clone
MAL cDNA Clone
Synonyms
MAL; N/A; MAL cDNA Clone; MAL cdna clone
Sequence
atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtctgtgttctgcttcgtggccaccaccaccttgatcatcctgtacataattggagcccacggtggagagacttcctgggtcaccttggacgcagcctaccactgcaccgctgccctcttttacctcagcgcctcagtcctggaggccctggccaccatcacgatgcaagacggcttcacctacaggcactaccatgaaaacattgctgccgtggtgttctcctacatagccactctgctctacgtggtccatgcggtgttctctttaatcagatggaagtcttcataa
Sequence Length
462
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
5,989 Da
NCBI Official Full Name
Homo sapiens mal, T-cell differentiation protein, mRNA
NCBI Official Synonym Full Names
mal, T-cell differentiation protein
NCBI Official Symbol
MAL
NCBI Protein Information
myelin and lymphocyte protein
UniProt Protein Name
Myelin and lymphocyte protein
UniProt Gene Name
MAL
UniProt Entry Name
MAL_HUMAN
Similar Products
Product Notes
The MAL mal (Catalog #AAA116237) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccccg cagcggcgac ggggggcagc accctgccca gtggcttctc ggtcttcacc accttgcccg acttgctctt catctttgag tttatcttcg ggggcctggt gtggatcctg gtggcctcct ccctggtgcc ctggcccctg gtccagggct gggtgatgtt cgtgtctgtg ttctgcttcg tggccaccac caccttgatc atcctgtaca taattggagc ccacggtgga gagacttcct gggtcacctt ggacgcagcc taccactgca ccgctgccct cttttacctc agcgcctcag tcctggaggc cctggccacc atcacgatgc aagacggctt cacctacagg cactaccatg aaaacattgc tgccgtggtg ttctcctaca tagccactct gctctacgtg gtccatgcgg tgttctcttt aatcagatgg aagtcttcat aa. It is sometimes possible for the material contained within the vial of "MAL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.