Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

NBPF1 cdna clone

NBPF1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
NBPF1; AD2; NBG; AB13; AB14; AB23; NBPF
Synonyms
NBPF1; N/A; NBPF1 cDNA Clone; NBPF1 cdna clone
Ordering
Sequence
atgctgaggaatgagcgacagttcaaggaggagaagcttgcagagcagctcaagcaagctgaggagctcaggcaatataaagtcctggttcactctcaggaacgagagctgacccagttaagggagaagttacgggaagggagagatgcctcctgctcattgaatcagcatctccaggccctcctcactccggatgagccagacaagtcccaggggcaggacctccaagaacagctggctgaggggtgtagactggcacagcaccttgtccaaaagctcagcccagaaaatgacaacgatgacgatgaagatgttcaagttgaggtggctgagaaagtgcagaaatcgtctgcccccagggagatgccgaaggctgaagaaaaggaagtccctgaggactcactggaggaatgtgccatcacttgttcaaatagccatggcccttatgactccaaccagccacataggaaaaccaaaatcacatttgaggaagacaaagtcgactcaactctcattggctcatcctctcatgttgaatgggaggatgctgtacacattatcccagaaaatgaaagtgatgatgaggaagaggaagaaaaagggccagtgtctcccaggaatctgcaggagtctgaagaggaggaagtcccccaggagtcctgggatgaaggttattcgactctctcaattcctcctgaaatgttggcctcgtacaagtcttacagcggcacatttcactcattagaggaacagcaagtctgcatggctgttgacataggcggacatcggtgggatcaagtgaaaaaggaggaccaagaggcaacaggtcccaggctcagcagggagctgctggatgagaaagggcctgaagtcttgcaggactcactggatagatgttattcaactccttcaggttatcttgaactgactgactcatgccagccctacagaagtgccttttacatattggagcaacagcgtgttggctgggctcttgacatggatgaaattgaaaagtaccaagaagtggaagaagaccaagacccatcatgccccaggctcagcagggagctgctggatgagaaagagcctgaagtcttgcaggactcactggatagatgttattcgactccttcaggttatcttgaactgcctgacttaggccagccctacagaagtgctgtttactcattggaggaacagtaccttggcttggctcttgacgtggacagaattaaaaaggaccaagaagaggaagaagaccaaggcccaccatgccccaggctcagcagggagctgctggaggcagtagagcctgaagtcttgcaggactcactggatagatgttattcaactccttccagttgtcttgaacagcctgactcctgcctgccctatggaagttccttttatgcattggaggaaaaacatgttggcttttctcttgacgtgggagaaattgaaaagaaggggaaggggaagaaaagaaggggaagaagatcaacgaagaaaagaaggagaaggggaagaaaagaaggggaagaagatcaaaacccaccatgccccaggctcagcggtgtgctgatggaagtggaagagcctgaagtcttacaggactcactggatagatgttattcgactccgtcaatgttctttgaactacctgactcattccagcactacagaagtgtgttttactcatttgaggaacagcacatcagcttcgcccttgacgtggacaataggtttcttactttgatgggaagaagtctccacctggtcttccagatgggagtcatattcccacaataa
Sequence Length
1812
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
139,343 Da
NCBI Official Full Name
Homo sapiens neuroblastoma breakpoint family, member 1, mRNA
NCBI Official Synonym Full Names
neuroblastoma breakpoint family member 1
NCBI Official Symbol
NBPF1
NCBI Official Synonym Symbols
AD2; NBG; AB13; AB14; AB23; NBPF
NCBI Protein Information
neuroblastoma breakpoint family member 1
UniProt Protein Name
Neuroblastoma breakpoint family member 1
UniProt Gene Name
NBPF1
UniProt Synonym Gene Names
KIAA1693
UniProt Entry Name
NBPF1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The NBPF1 nbpf1 (Catalog #AAA116433) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagga atgagcgaca gttcaaggag gagaagcttg cagagcagct caagcaagct gaggagctca ggcaatataa agtcctggtt cactctcagg aacgagagct gacccagtta agggagaagt tacgggaagg gagagatgcc tcctgctcat tgaatcagca tctccaggcc ctcctcactc cggatgagcc agacaagtcc caggggcagg acctccaaga acagctggct gaggggtgta gactggcaca gcaccttgtc caaaagctca gcccagaaaa tgacaacgat gacgatgaag atgttcaagt tgaggtggct gagaaagtgc agaaatcgtc tgcccccagg gagatgccga aggctgaaga aaaggaagtc cctgaggact cactggagga atgtgccatc acttgttcaa atagccatgg cccttatgac tccaaccagc cacataggaa aaccaaaatc acatttgagg aagacaaagt cgactcaact ctcattggct catcctctca tgttgaatgg gaggatgctg tacacattat cccagaaaat gaaagtgatg atgaggaaga ggaagaaaaa gggccagtgt ctcccaggaa tctgcaggag tctgaagagg aggaagtccc ccaggagtcc tgggatgaag gttattcgac tctctcaatt cctcctgaaa tgttggcctc gtacaagtct tacagcggca catttcactc attagaggaa cagcaagtct gcatggctgt tgacataggc ggacatcggt gggatcaagt gaaaaaggag gaccaagagg caacaggtcc caggctcagc agggagctgc tggatgagaa agggcctgaa gtcttgcagg actcactgga tagatgttat tcaactcctt caggttatct tgaactgact gactcatgcc agccctacag aagtgccttt tacatattgg agcaacagcg tgttggctgg gctcttgaca tggatgaaat tgaaaagtac caagaagtgg aagaagacca agacccatca tgccccaggc tcagcaggga gctgctggat gagaaagagc ctgaagtctt gcaggactca ctggatagat gttattcgac tccttcaggt tatcttgaac tgcctgactt aggccagccc tacagaagtg ctgtttactc attggaggaa cagtaccttg gcttggctct tgacgtggac agaattaaaa aggaccaaga agaggaagaa gaccaaggcc caccatgccc caggctcagc agggagctgc tggaggcagt agagcctgaa gtcttgcagg actcactgga tagatgttat tcaactcctt ccagttgtct tgaacagcct gactcctgcc tgccctatgg aagttccttt tatgcattgg aggaaaaaca tgttggcttt tctcttgacg tgggagaaat tgaaaagaag gggaagggga agaaaagaag gggaagaaga tcaacgaaga aaagaaggag aaggggaaga aaagaagggg aagaagatca aaacccacca tgccccaggc tcagcggtgt gctgatggaa gtggaagagc ctgaagtctt acaggactca ctggatagat gttattcgac tccgtcaatg ttctttgaac tacctgactc attccagcac tacagaagtg tgttttactc atttgaggaa cagcacatca gcttcgccct tgacgtggac aataggtttc ttactttgat gggaagaagt ctccacctgg tcttccagat gggagtcata ttcccacaat aa. It is sometimes possible for the material contained within the vial of "NBPF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.