NPFFR2 cdna clone
NPFFR2 cDNA Clone
Gene Names
NPFFR2; GPR74; NPFF2; NPGPR; HLWAR77
Synonyms
NPFFR2; N/A; NPFFR2 cDNA Clone; NPFFR2 cdna clone
Sequence
atgaatgagaaatgggacacaaactcttcagaaaactggcatcccatctggaatgtcaatgacacaaagcatcatctgtactcagatattaatattacctatgtgaactactatcttcaccagcctcaagtggcagcaatcttcattatttcctactttctgatcttctttttgtgcatgatgggaaatactgtggtttgctttattgtaatgaggaacaaacatatgcacacagtcactaatctcttcatcttaaacctggccataagtgatttactagttggcatattctgcatgcctataacactgctggacaatattatagcaggatggccatttggaaacacgatgtgcaagatcagtggattggtccagggaatatctgtcgcagcttcagtctttacgttagttgcaattgctgtagataggttccagtgtgtggtctacccttttaaaccaaagctcactatcaagacagcgtttgtcattattatgatcatctgggtcctagccatcaccattatgtctccatctgcagtaatgttacatgtgcaagaagaaaaatattaccgagtgagactcaactcccagaataaaaccagtccagtctactggtgccgggaagactggccaaatcaggaaatgaggaagatctacaccactgtgctgtttgccaacatctacctggctcccctctccctcattgtcatcatgtatggaaggattggaatttcactcttcagggctgcagttcctcacacaggcaggaagaaccaggagcagtggcacgtggtgtccaggaagaagcagaagatcattaagatgctcctgattgtggccctgctttttattctctcatggctgcccctgtggactctaatgatgctctcagactacgctgacctttctccaaatgaactgcagatcatcaacatctacatctacccttttgcacactggctggcattcggcaacagcagtgtcaatcccatcatttatggtttcttcaacgagaatttccgccgtggtttccaagaagctttccagctccagctctgccaaaaaagagcaaagcctatggaagcttatgccctaaaagctaaaagccatgtgctcataaacacatctaatcagcttgtccaggaatctacatttcaaaaccctcatggggaaaccttgctttataggaaaagtgctgaaaaaccccaacaggaattagtgatggaagaattaaaagaaactactaacagcagtgagatttaa
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,055 Da
NCBI Official Full Name
Homo sapiens neuropeptide FF receptor 2, mRNA
NCBI Official Synonym Full Names
neuropeptide FF receptor 2
NCBI Official Symbol
NPFFR2
NCBI Official Synonym Symbols
GPR74; NPFF2; NPGPR; HLWAR77
NCBI Protein Information
neuropeptide FF receptor 2
UniProt Protein Name
Neuropeptide FF receptor 2
UniProt Gene Name
NPFFR2
UniProt Synonym Gene Names
GPR74; NPFF2; NPGPR
UniProt Entry Name
NPFF2_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The NPFFR2 npffr2 (Catalog #AAA116269) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaga aatgggacac aaactcttca gaaaactggc atcccatctg gaatgtcaat gacacaaagc atcatctgta ctcagatatt aatattacct atgtgaacta ctatcttcac cagcctcaag tggcagcaat cttcattatt tcctactttc tgatcttctt tttgtgcatg atgggaaata ctgtggtttg ctttattgta atgaggaaca aacatatgca cacagtcact aatctcttca tcttaaacct ggccataagt gatttactag ttggcatatt ctgcatgcct ataacactgc tggacaatat tatagcagga tggccatttg gaaacacgat gtgcaagatc agtggattgg tccagggaat atctgtcgca gcttcagtct ttacgttagt tgcaattgct gtagataggt tccagtgtgt ggtctaccct tttaaaccaa agctcactat caagacagcg tttgtcatta ttatgatcat ctgggtccta gccatcacca ttatgtctcc atctgcagta atgttacatg tgcaagaaga aaaatattac cgagtgagac tcaactccca gaataaaacc agtccagtct actggtgccg ggaagactgg ccaaatcagg aaatgaggaa gatctacacc actgtgctgt ttgccaacat ctacctggct cccctctccc tcattgtcat catgtatgga aggattggaa tttcactctt cagggctgca gttcctcaca caggcaggaa gaaccaggag cagtggcacg tggtgtccag gaagaagcag aagatcatta agatgctcct gattgtggcc ctgcttttta ttctctcatg gctgcccctg tggactctaa tgatgctctc agactacgct gacctttctc caaatgaact gcagatcatc aacatctaca tctacccttt tgcacactgg ctggcattcg gcaacagcag tgtcaatccc atcatttatg gtttcttcaa cgagaatttc cgccgtggtt tccaagaagc tttccagctc cagctctgcc aaaaaagagc aaagcctatg gaagcttatg ccctaaaagc taaaagccat gtgctcataa acacatctaa tcagcttgtc caggaatcta catttcaaaa ccctcatggg gaaaccttgc tttataggaa aagtgctgaa aaaccccaac aggaattagt gatggaagaa ttaaaagaaa ctactaacag cagtgagatt taa. It is sometimes possible for the material contained within the vial of "NPFFR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.