Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

OLFM1 cdna clone

OLFM1 cDNA Clone

Gene Names
OLFM1; AMY; NOE1; OlfA; NOELIN1
Synonyms
OLFM1; N/A; OLFM1 cDNA Clone; OLFM1 cdna clone
Ordering
Sequence
atgccaggtcgttggaggtggcagcgagacatgcacccggcccggaagctcctcagcctcctcttcctcatcctgatgggcactgaactcactcaagtgctgcccaccaaccctgaggagagctggcaggtgtacagctctgcccaggacagcgagggcaggtgtatctgcacagtggtcgccccacagcagaccatgtgttcacgggatgcccgcacaaaacagctgaggcagctactggagaaggtgcagaacatgtctcaatccatagaggtcttggacaggcggacccagagagacttgcagtacgtggagaagatggagaaccaaatgaaaggactggagtccaagttcaaacaggtggaggagagtcataagcaacacctggccaggcagtttaaggcgataaaagcgaaaatggatgaacttaggcctttgatacctgtgttggaagagtacaaggccgatgccaaattggtattgcagtttaaagaggaggtccagaatctgacgtcagtgcttaacgagctgcaagaggaaattggcgcctatgactacgatgaacttcagagcagagtgtccaatcttgaagaaaggctccgtgcatgcatgcaaaaactagcttgcgggaagttgacgggcatcagtgaccccgtgactgtcaagacctccggctcgaggttcggatcctggatgacagaccctctcgcccctgaaggcgataaccgggtgtggtacatggacggctatcacaacaaccgcttcgtacgtgagtacaagtccatggttgacttcatgaacacggacaatttcacctcccaccgtctcccccacccctggtcgggcacggggcaggtggtctacaacggttctatctacttcaacaagttccagagccacatcatcatcaggtttgacctgaagacagagaccatcctcaagacccgcagcctggactatgccggttacaacaacatgtaccactacgcctggggtggccactcggacatcgacctcatggtggacgagagcgggctgtgggccgtgtacgccaccaaccagaacgctggcaacatcgtggtcagtaggctggaccccgtgtccctgcagaccctgcagacctggaacacgagctaccccaagcgcagcgccggggaggccttcatcatctgcggcacgctgtacgtcaccaacggctactcagggggtaccaaggtccactatgcataccagaccaatgcctccacctatgaatacatcgacatcccattccagaacaaatactcccacatctccatgctggactacaaccccaaggaccgggccctgtatgcctggaacaacggccaccagatcctctacaacgtgaccctcttccacgtcatccgctccgacgagttgtag
Sequence Length
1404
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,815 Da
NCBI Official Full Name
Homo sapiens olfactomedin 1, mRNA
NCBI Official Synonym Full Names
olfactomedin 1
NCBI Official Symbol
OLFM1
NCBI Official Synonym Symbols
AMY; NOE1; OlfA; NOELIN1
NCBI Protein Information
noelin
UniProt Protein Name
Noelin
UniProt Gene Name
OLFM1
UniProt Synonym Gene Names
NOE1; NOEL1
UniProt Entry Name
NOE1_HUMAN

Similar Products

Product Notes

The OLFM1 olfm1 (Catalog #AAA116266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaggtc gttggaggtg gcagcgagac atgcacccgg cccggaagct cctcagcctc ctcttcctca tcctgatggg cactgaactc actcaagtgc tgcccaccaa ccctgaggag agctggcagg tgtacagctc tgcccaggac agcgagggca ggtgtatctg cacagtggtc gccccacagc agaccatgtg ttcacgggat gcccgcacaa aacagctgag gcagctactg gagaaggtgc agaacatgtc tcaatccata gaggtcttgg acaggcggac ccagagagac ttgcagtacg tggagaagat ggagaaccaa atgaaaggac tggagtccaa gttcaaacag gtggaggaga gtcataagca acacctggcc aggcagttta aggcgataaa agcgaaaatg gatgaactta ggcctttgat acctgtgttg gaagagtaca aggccgatgc caaattggta ttgcagttta aagaggaggt ccagaatctg acgtcagtgc ttaacgagct gcaagaggaa attggcgcct atgactacga tgaacttcag agcagagtgt ccaatcttga agaaaggctc cgtgcatgca tgcaaaaact agcttgcggg aagttgacgg gcatcagtga ccccgtgact gtcaagacct ccggctcgag gttcggatcc tggatgacag accctctcgc ccctgaaggc gataaccggg tgtggtacat ggacggctat cacaacaacc gcttcgtacg tgagtacaag tccatggttg acttcatgaa cacggacaat ttcacctccc accgtctccc ccacccctgg tcgggcacgg ggcaggtggt ctacaacggt tctatctact tcaacaagtt ccagagccac atcatcatca ggtttgacct gaagacagag accatcctca agacccgcag cctggactat gccggttaca acaacatgta ccactacgcc tggggtggcc actcggacat cgacctcatg gtggacgaga gcgggctgtg ggccgtgtac gccaccaacc agaacgctgg caacatcgtg gtcagtaggc tggaccccgt gtccctgcag accctgcaga cctggaacac gagctacccc aagcgcagcg ccggggaggc cttcatcatc tgcggcacgc tgtacgtcac caacggctac tcagggggta ccaaggtcca ctatgcatac cagaccaatg cctccaccta tgaatacatc gacatcccat tccagaacaa atactcccac atctccatgc tggactacaa ccccaaggac cgggccctgt atgcctggaa caacggccac cagatcctct acaacgtgac cctcttccac gtcatccgct ccgacgagtt gtag. It is sometimes possible for the material contained within the vial of "OLFM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.