OLFM2 cdna clone
OLFM2 cDNA Clone
Gene Names
OLFM2; NOE2; OlfC; NOELIN2; NOELIN2_V1
Synonyms
OLFM2; N/A; OLFM2 cDNA Clone; OLFM2 cdna clone
Sequence
atgtggccgctcacggtcccgccgccgctgctgctgctgctgtgctcaggcctggccggacagactctcttccagaacccagaagagggctggcagctgtacacctcagcccaggcccctgacgggaaatgcatctgcacggccgtgatcccagcgcagagtacctgctctcgagatggcaggagtcgggagctgcggcaactgatggagaaggtccagaacgtctcccagtccatggaggtccttgagttgcggacgtatcgcgacctccagtatgtacgcggcatggagaccctcatgcggagcctggatgcgcggctccgggcagctgatgggtccctctcggccaagagcttccaggagctgaaggacaggatgacggaactgttgcccctgagctcggtcctggagcagtacaaggcagacacgcggaccattgtacgcttgcgggaggaggtgaggaatctctccggcagtctggcggccattcaggaggagatgggtgcctacgggtatgaggacctgcagcaacgggtgatggccctggaggcccggctccacgcctgcgcccagaagctgggctgtgggaagctgaccggggtcagtaaccccatcaccgttcgggccatggggtcccgcttcggctcctggatgactgacacgatggcccccagtgcggatagccgggtctggtacatggatggctattacaaaggccgccgggtcctggagttccgtaccctgggagacttcatcaaaggccagaactttatccagcacctgctgccccagccgtgggcgggcacgggccacgtggtgtacaacggctccctgttctataacaagtaccagagcaacgtggtggtcaaataccacttccgctcgcgctctgtgctggtgcagaggagcctcccgggcgccggttacaacaacaccttcccctactcctggggcggcttctccgacatggacttcatggtggacgagagcgggctctgggctgtgtacaccaccaaccagaacgcgggcaacatcgtggtcagccggctggacccgcacaccctcgaggtcatgcggtcctgggacaccggctaccccaagcgcagcgctggcgaggccttcatgatctgcggtgtgctctacgtgaccaactcccacctggctggggccaaggtctacttcgcctattttaccaacacgtccagttacgagtacacggacgtgcccttccacaaccagtattcccacatctcgatgctggattacaacccccgggagcgcgccctctatacctggaacaacggccaccaggtgctctacaatgtcaccctgtttcacgtcatcagcacctctggggacccctga
Sequence Length
1365
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,386 Da
NCBI Official Full Name
Homo sapiens olfactomedin 2, mRNA
NCBI Official Synonym Full Names
olfactomedin 2
NCBI Official Symbol
OLFM2
NCBI Official Synonym Symbols
NOE2; OlfC; NOELIN2; NOELIN2_V1
NCBI Protein Information
noelin-2
UniProt Protein Name
Noelin-2
UniProt Gene Name
OLFM2
UniProt Synonym Gene Names
NOE2
UniProt Entry Name
NOE2_HUMAN
Similar Products
Product Notes
The OLFM2 olfm2 (Catalog #AAA116235) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggccgc tcacggtccc gccgccgctg ctgctgctgc tgtgctcagg cctggccgga cagactctct tccagaaccc agaagagggc tggcagctgt acacctcagc ccaggcccct gacgggaaat gcatctgcac ggccgtgatc ccagcgcaga gtacctgctc tcgagatggc aggagtcggg agctgcggca actgatggag aaggtccaga acgtctccca gtccatggag gtccttgagt tgcggacgta tcgcgacctc cagtatgtac gcggcatgga gaccctcatg cggagcctgg atgcgcggct ccgggcagct gatgggtccc tctcggccaa gagcttccag gagctgaagg acaggatgac ggaactgttg cccctgagct cggtcctgga gcagtacaag gcagacacgc ggaccattgt acgcttgcgg gaggaggtga ggaatctctc cggcagtctg gcggccattc aggaggagat gggtgcctac gggtatgagg acctgcagca acgggtgatg gccctggagg cccggctcca cgcctgcgcc cagaagctgg gctgtgggaa gctgaccggg gtcagtaacc ccatcaccgt tcgggccatg gggtcccgct tcggctcctg gatgactgac acgatggccc ccagtgcgga tagccgggtc tggtacatgg atggctatta caaaggccgc cgggtcctgg agttccgtac cctgggagac ttcatcaaag gccagaactt tatccagcac ctgctgcccc agccgtgggc gggcacgggc cacgtggtgt acaacggctc cctgttctat aacaagtacc agagcaacgt ggtggtcaaa taccacttcc gctcgcgctc tgtgctggtg cagaggagcc tcccgggcgc cggttacaac aacaccttcc cctactcctg gggcggcttc tccgacatgg acttcatggt ggacgagagc gggctctggg ctgtgtacac caccaaccag aacgcgggca acatcgtggt cagccggctg gacccgcaca ccctcgaggt catgcggtcc tgggacaccg gctaccccaa gcgcagcgct ggcgaggcct tcatgatctg cggtgtgctc tacgtgacca actcccacct ggctggggcc aaggtctact tcgcctattt taccaacacg tccagttacg agtacacgga cgtgcccttc cacaaccagt attcccacat ctcgatgctg gattacaacc cccgggagcg cgccctctat acctggaaca acggccacca ggtgctctac aatgtcaccc tgtttcacgt catcagcacc tctggggacc cctga. It is sometimes possible for the material contained within the vial of "OLFM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.