OLFM3 cdna clone
OLFM3 cDNA Clone
Gene Names
OLFM3; NOE3; NOELIN3; OPTIMEDIN
Synonyms
OLFM3; N/A; OLFM3 cDNA Clone; OLFM3 cdna clone
Sequence
atgcaggcgacgtccaaccttctcaacctcctgctgctgtctttgtttgccggattagatccttccaagactcagattagtcctaaagaagggtggcaggtgtacagctcagctcaggatcctgatgggcggtgcatttgtacagttgttgctccagaacaaaacctgtgttcccgggatgccaaaagcaggcaacttcgcaaactactggaaaaggttcagaacatgtcccagtctattgaagtcttaaacttgagaactcagagagatttccaatatgttttaaaaatggaaacccaaatgaaagggctgaaggcaaaatttcggcagattgaagatgatcgaaagacacttatgaccaagcattttcaggagttgaaagagaaaatggacgagctcctgcctttgatccccgtgctggaacagtacaaaacagatgctaagttaatcacccagttcaaggaggaaataaggaatctgtctgctgtcctcactggtattcaggaggaaattggtgcctatgactacgaggaactacaccaaagagtgctgagcttggaaacaagacttcgtgactgcatgaaaaagctaacatgtggcaaactgatgaaaatcacaggcccagttacagtcaagacatctggaacccgatttggtgcttggatgacagaccctttagcatctgagaaaaacaacagagtctggtacatggacagttatactaacaataaaattgttcgtgaatacaaatcaattgcagactttgtcagtggggctgaatcaaggacatacaaccttcctttcaagtgggcaggaactaaccatgttgtctacaatggctcactctattttaacaagtatcagagtaatatcatcatcaaatacagctttgatatggggagagtgcttgcccaacgaagcctggagtatgctggttttcataatgtttacccctacacatggggtggattctctgacatcgacctaatggctgatgaaatcgggctgtgggctgtgtatgcaactaaccagaatgcaggcaatattgtcatcagccaacttaaccaagataccttggaggtgatgaagagctggagcactggctaccccaagagaagtgcaggggaatctttcatgatctgtgggacactgtatgtcaccaactcccacttaactggagccaaggtgtattattcctattccaccaaaacctccacatatgagtacacagacattcccttccataaccaatactttcacatatccatgcttgactacaatgcaagagatcgagctctctgtgcctggaacaatggccaccaggtgctgttcaatgtcacccttttccatatcatcaagacagaggatgacacatag
Sequence Length
1377
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
16,790 Da
NCBI Official Full Name
Homo sapiens olfactomedin 3, mRNA
NCBI Official Synonym Full Names
olfactomedin 3
NCBI Official Symbol
OLFM3
NCBI Official Synonym Symbols
NOE3; NOELIN3; OPTIMEDIN
NCBI Protein Information
noelin-3
UniProt Protein Name
Noelin-3
UniProt Gene Name
OLFM3
UniProt Synonym Gene Names
NOE3
UniProt Entry Name
NOE3_HUMAN
Similar Products
Product Notes
The OLFM3 olfm3 (Catalog #AAA116417) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcga cgtccaacct tctcaacctc ctgctgctgt ctttgtttgc cggattagat ccttccaaga ctcagattag tcctaaagaa gggtggcagg tgtacagctc agctcaggat cctgatgggc ggtgcatttg tacagttgtt gctccagaac aaaacctgtg ttcccgggat gccaaaagca ggcaacttcg caaactactg gaaaaggttc agaacatgtc ccagtctatt gaagtcttaa acttgagaac tcagagagat ttccaatatg ttttaaaaat ggaaacccaa atgaaagggc tgaaggcaaa atttcggcag attgaagatg atcgaaagac acttatgacc aagcattttc aggagttgaa agagaaaatg gacgagctcc tgcctttgat ccccgtgctg gaacagtaca aaacagatgc taagttaatc acccagttca aggaggaaat aaggaatctg tctgctgtcc tcactggtat tcaggaggaa attggtgcct atgactacga ggaactacac caaagagtgc tgagcttgga aacaagactt cgtgactgca tgaaaaagct aacatgtggc aaactgatga aaatcacagg cccagttaca gtcaagacat ctggaacccg atttggtgct tggatgacag accctttagc atctgagaaa aacaacagag tctggtacat ggacagttat actaacaata aaattgttcg tgaatacaaa tcaattgcag actttgtcag tggggctgaa tcaaggacat acaaccttcc tttcaagtgg gcaggaacta accatgttgt ctacaatggc tcactctatt ttaacaagta tcagagtaat atcatcatca aatacagctt tgatatgggg agagtgcttg cccaacgaag cctggagtat gctggttttc ataatgttta cccctacaca tggggtggat tctctgacat cgacctaatg gctgatgaaa tcgggctgtg ggctgtgtat gcaactaacc agaatgcagg caatattgtc atcagccaac ttaaccaaga taccttggag gtgatgaaga gctggagcac tggctacccc aagagaagtg caggggaatc tttcatgatc tgtgggacac tgtatgtcac caactcccac ttaactggag ccaaggtgta ttattcctat tccaccaaaa cctccacata tgagtacaca gacattccct tccataacca atactttcac atatccatgc ttgactacaa tgcaagagat cgagctctct gtgcctggaa caatggccac caggtgctgt tcaatgtcac ccttttccat atcatcaaga cagaggatga cacatag. It is sometimes possible for the material contained within the vial of "OLFM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.