PHC2 cdna clone
PHC2 cDNA Clone
Gene Names
PHC2; PH2; EDR2; HPH2
Synonyms
PHC2; N/A; PHC2 cDNA Clone; PHC2 cdna clone
Sequence
atgacctcagggaacggaaactctgcctccagcatcgccggcactgccccccagaatggtgagaataaaccaccacaggccattgtgaaaccccaaatcctgacgcatgttatcgaagggtttgtgatccaggagggggcggagcctttcccggtgggacgctcgtccctgctggtggggaatctcaagaagaagtatgcacaggggttcctgcctgagaaacttccacagcaggatcacaccaccaccactgactcggagatggaggagccctatctgcaagaatccaaagaggagggtgcccccctcaaactcaagtgtgagctctgtggccgggtggactttgcctataagttcaagcgttccaagcgcttctgttccatggcttgtgcaaagaggtacaacgtgggatgcaccaaacgggtgggacttttccactcagaccggagcaagctgcagaaggcaggagctgcgacccacaaccgccgtcgggccagcaaagccagtctgccaccacttaccaaggataccaagaagcagccaacaggcactgtgcccctttcggttactgctgctttgcagctaacacacagccaggaagactccagccgttgctcagataactcaagctatgaggaacccttgtcacccatctcagccagctcatctacttcccgccggcgacaaggccagcgggacctggagctccccgacatgcatatgcgggacctggtgggcatgggacaccacttcctgccaagtgagcccaccaagtggaatgtagaagacgtctacgaattcatccgctctctgccaggctgccaggagatagaagaggaattccgtgcccaggaaatcgacgggcaagccctgctgctgctcaaggaggaccacctgatgagcgccatgaacatcaagctggggcccgccctgaagatctatgcccgcatcagcatgctcaaggactcctag
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
90,812 Da
NCBI Official Full Name
Homo sapiens polyhomeotic homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
polyhomeotic homolog 2
NCBI Official Symbol
PHC2
NCBI Official Synonym Symbols
PH2; EDR2; HPH2
NCBI Protein Information
polyhomeotic-like protein 2
UniProt Protein Name
Polyhomeotic-like protein 2
UniProt Gene Name
PHC2
UniProt Synonym Gene Names
EDR2; PH2; hPH2
UniProt Entry Name
PHC2_HUMAN
Similar Products
Product Notes
The PHC2 phc2 (Catalog #AAA116386) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctcag ggaacggaaa ctctgcctcc agcatcgccg gcactgcccc ccagaatggt gagaataaac caccacaggc cattgtgaaa ccccaaatcc tgacgcatgt tatcgaaggg tttgtgatcc aggagggggc ggagcctttc ccggtgggac gctcgtccct gctggtgggg aatctcaaga agaagtatgc acaggggttc ctgcctgaga aacttccaca gcaggatcac accaccacca ctgactcgga gatggaggag ccctatctgc aagaatccaa agaggagggt gcccccctca aactcaagtg tgagctctgt ggccgggtgg actttgccta taagttcaag cgttccaagc gcttctgttc catggcttgt gcaaagaggt acaacgtggg atgcaccaaa cgggtgggac ttttccactc agaccggagc aagctgcaga aggcaggagc tgcgacccac aaccgccgtc gggccagcaa agccagtctg ccaccactta ccaaggatac caagaagcag ccaacaggca ctgtgcccct ttcggttact gctgctttgc agctaacaca cagccaggaa gactccagcc gttgctcaga taactcaagc tatgaggaac ccttgtcacc catctcagcc agctcatcta cttcccgccg gcgacaaggc cagcgggacc tggagctccc cgacatgcat atgcgggacc tggtgggcat gggacaccac ttcctgccaa gtgagcccac caagtggaat gtagaagacg tctacgaatt catccgctct ctgccaggct gccaggagat agaagaggaa ttccgtgccc aggaaatcga cgggcaagcc ctgctgctgc tcaaggagga ccacctgatg agcgccatga acatcaagct ggggcccgcc ctgaagatct atgcccgcat cagcatgctc aaggactcct ag. It is sometimes possible for the material contained within the vial of "PHC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.