Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

PHC2 cdna clone

PHC2 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
PHC2; PH2; EDR2; HPH2
Synonyms
PHC2; N/A; PHC2 cDNA Clone; PHC2 cdna clone
Ordering
Sequence
atgacctcagggaacggaaactctgcctccagcatcgccggcactgccccccagaatggtgagaataaaccaccacaggccattgtgaaaccccaaatcctgacgcatgttatcgaagggtttgtgatccaggagggggcggagcctttcccggtgggacgctcgtccctgctggtggggaatctcaagaagaagtatgcacaggggttcctgcctgagaaacttccacagcaggatcacaccaccaccactgactcggagatggaggagccctatctgcaagaatccaaagaggagggtgcccccctcaaactcaagtgtgagctctgtggccgggtggactttgcctataagttcaagcgttccaagcgcttctgttccatggcttgtgcaaagaggtacaacgtgggatgcaccaaacgggtgggacttttccactcagaccggagcaagctgcagaaggcaggagctgcgacccacaaccgccgtcgggccagcaaagccagtctgccaccacttaccaaggataccaagaagcagccaacaggcactgtgcccctttcggttactgctgctttgcagctaacacacagccaggaagactccagccgttgctcagataactcaagctatgaggaacccttgtcacccatctcagccagctcatctacttcccgccggcgacaaggccagcgggacctggagctccccgacatgcatatgcgggacctggtgggcatgggacaccacttcctgccaagtgagcccaccaagtggaatgtagaagacgtctacgaattcatccgctctctgccaggctgccaggagatagaagaggaattccgtgcccaggaaatcgacgggcaagccctgctgctgctcaaggaggaccacctgatgagcgccatgaacatcaagctggggcccgccctgaagatctatgcccgcatcagcatgctcaaggactcctag
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,812 Da
NCBI Official Full Name
Homo sapiens polyhomeotic homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
polyhomeotic homolog 2
NCBI Official Symbol
PHC2
NCBI Official Synonym Symbols
PH2; EDR2; HPH2
NCBI Protein Information
polyhomeotic-like protein 2
UniProt Protein Name
Polyhomeotic-like protein 2
UniProt Gene Name
PHC2
UniProt Synonym Gene Names
EDR2; PH2; hPH2
UniProt Entry Name
PHC2_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The PHC2 phc2 (Catalog #AAA116386) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctcag ggaacggaaa ctctgcctcc agcatcgccg gcactgcccc ccagaatggt gagaataaac caccacaggc cattgtgaaa ccccaaatcc tgacgcatgt tatcgaaggg tttgtgatcc aggagggggc ggagcctttc ccggtgggac gctcgtccct gctggtgggg aatctcaaga agaagtatgc acaggggttc ctgcctgaga aacttccaca gcaggatcac accaccacca ctgactcgga gatggaggag ccctatctgc aagaatccaa agaggagggt gcccccctca aactcaagtg tgagctctgt ggccgggtgg actttgccta taagttcaag cgttccaagc gcttctgttc catggcttgt gcaaagaggt acaacgtggg atgcaccaaa cgggtgggac ttttccactc agaccggagc aagctgcaga aggcaggagc tgcgacccac aaccgccgtc gggccagcaa agccagtctg ccaccactta ccaaggatac caagaagcag ccaacaggca ctgtgcccct ttcggttact gctgctttgc agctaacaca cagccaggaa gactccagcc gttgctcaga taactcaagc tatgaggaac ccttgtcacc catctcagcc agctcatcta cttcccgccg gcgacaaggc cagcgggacc tggagctccc cgacatgcat atgcgggacc tggtgggcat gggacaccac ttcctgccaa gtgagcccac caagtggaat gtagaagacg tctacgaatt catccgctct ctgccaggct gccaggagat agaagaggaa ttccgtgccc aggaaatcga cgggcaagcc ctgctgctgc tcaaggagga ccacctgatg agcgccatga acatcaagct ggggcccgcc ctgaagatct atgcccgcat cagcatgctc aaggactcct ag. It is sometimes possible for the material contained within the vial of "PHC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request Manual

Please complete the form below and a representative will contact you as soon as possible.

Request Quote

Please complete the form below and a representative will contact you as soon as possible.