PIN1 cDNA Clone – Homo Sapiens Peptidylprolyl Cis/Trans Isomerase, NIMA-Interacting 1, Mrna
PIN1 cDNA Clone
Gene Names
PIN1; DOD; UBL5
Synonyms
PIN1; N/A; PIN1 cDNA Clone; PIN1 cdna clone
Product Overview
Sequence
atggcggacgaggagaagctgccgcccggctgggagaagcgcatgagccgcagctcaggccgagtgtactacttcaaccacatcactaacgccagccagtgggagcggcccagcggcaacagcagcagtggtggcaaaaacgggcagggggagcctgccagggtccgctgctcgcacctgctggtgaagcacagccagtcacggcggccctcgtcctggcggcaggagaagatcacccggaccaaggaggaggccctggagctgatcaacggctacatccagaagatcaagtcgggagaggaggactttgagtctctggcctcacagttcagcgactgcagctcagccaaggccaggggagacctgggtgccttcagcagaggtcagatgcagaagccatttgaagacgcctcgtttgcgctgcggacgggggagatgagcgggcccgtgttcacggattccggcatccacatcatcctccgcactgagtga
Sequence Length
492
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,243 Da
NCBI Official Full Name
Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 1, mRNA
NCBI Official Synonym Full Names
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
NCBI Official Symbol
PIN1
NCBI Official Synonym Symbols
DOD; UBL5
NCBI Protein Information
peptidyl-prolyl cis-trans isomerase NIMA-interacting 1
UniProt Protein Name
Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1
UniProt Gene Name
PIN1
UniProt Synonym Gene Names
PPIase Pin1
UniProt Entry Name
PIN1_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The PIN1 pin1 (Catalog #AAA116248) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg aggagaagct gccgcccggc tgggagaagc gcatgagccg cagctcaggc cgagtgtact acttcaacca catcactaac gccagccagt gggagcggcc cagcggcaac agcagcagtg gtggcaaaaa cgggcagggg gagcctgcca gggtccgctg ctcgcacctg ctggtgaagc acagccagtc acggcggccc tcgtcctggc ggcaggagaa gatcacccgg accaaggagg aggccctgga gctgatcaac ggctacatcc agaagatcaa gtcgggagag gaggactttg agtctctggc ctcacagttc agcgactgca gctcagccaa ggccagggga gacctgggtg ccttcagcag aggtcagatg cagaagccat ttgaagacgc ctcgtttgcg ctgcggacgg gggagatgag cgggcccgtg ttcacggatt ccggcatcca catcatcctc cgcactgagt ga. It is sometimes possible for the material contained within the vial of "PIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.