Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

PTPN9 cdna clone

PTPN9 cDNA Clone

Gene Names
PTPN9; MEG2; PTPMEG2
Synonyms
PTPN9; N/A; PTPN9 cDNA Clone; PTPN9 cdna clone
Ordering
Sequence
atggagcccgcgaccgcgccccggcccgacatggcgccggagctgaccccggaggaggagcaggctaccaagcagtttctcgaagagattaacaagtggacagttcagtacaatgtttccccgctgtcttggaatgtggctgtcaagttcctcatggcaaggaagtttgatgtgctccgtgccatagaattgttccactcctacagagaaactcgaaggaaggaaggcattgtaaagctgaaacctcatgaggaacctcttcgttctgagatcctcagtggaaaattcaccatcttaaatgttcgggacccaacaggagcctccattgccctctttactgccaggttgcatcatccccacaagtcagtccaacatgtggtacttcaggctctgttttacttgctagacagagctgtggatagctttgaaactcagaggaatggactggtgtttatctatgacatgtgtggttctaattatgccaactttgagctggatcttggcaagaaagtcctaaacctgctgaagggagcatttccagctcgtttgaagaaggtgctgattgtgggggcacccatatggttccgagtgccctattccatcatcagtctcctcctgaaggacaaagtccgggagaggattcaaatattaaagacatctgaggtcacgcagcatctgcccagggagtgtcttccagaaaacctgggtgggtacgtcaaaattgatctcgccacttggaatttccagttcctaccccaggtgaacggccacccagatcccttcgatgagatcatcctgttctccctccctcctgccttagactgggactcagtacatgttccaggtccccatgctatgaccatccaagagttggtggactatgttaatgccaggcaaaagcaaggaatctatgaggaatatgaagacattcgtcgtgagaaccctgttggcactttccactgttccatgtctccaggaaacctagagaaaaaccgttatggggatgtaccctgcctggaccaaactagagtgaagctaacaaagcgaagtggccatactcagacagattacatcaatgccagtttcatggatggctacaagcagaagaatgcttacattggcacacaaggtcctttggagaatacctatcgtgatttctggctcatggtatgggagcaaaaagtcttggtgattgtcatgaccacccgctttgaggaaggcggcaggagaaagtgtggccagtactggcctttagaaaaagactctcggatccgatttggcttcctcacagtgaccaatctaggcgtggagaacatgaatcattataagaaaacaacgctagaaattcacaacacagaggaacggcagaaacgccaggtgacccacttccagttcttgagctggccagactatggtgtcccttcctcagcagcttccctcattgacttcttgagagtggtcagaaaccagcagagtctggctgtgagcaacatgggagcacgctccaaagggcagtgccctgagccacccattgtggtccattgcagtgcaggcattggcaggacaggtaccttctgctcactggacatctgcctggcacagctggaggagcttggcacccttaatgtgttccagacggtgtcacgcatgaggacccagagggccttcagcatccagacccctgagcagtactatttttgctacaaggccatcctggagttcgcagagaaggagggcatggtatcctctggccaaaacctgctggccgtggagagtcagtaa
Sequence Length
1782
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
68,020 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, non-receptor type 9, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, non-receptor type 9
NCBI Official Symbol
PTPN9
NCBI Official Synonym Symbols
MEG2; PTPMEG2
NCBI Protein Information
tyrosine-protein phosphatase non-receptor type 9; PTPase MEG2; PTPase-MEG2; protein-tyrosine phosphatase MEG2
UniProt Protein Name
Tyrosine-protein phosphatase non-receptor type 9
UniProt Gene Name
PTPN9
UniProt Synonym Gene Names
PTPase MEG2
UniProt Entry Name
PTN9_HUMAN

Similar Products

Product Notes

The PTPN9 ptpn9 (Catalog #AAA116307) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcccg cgaccgcgcc ccggcccgac atggcgccgg agctgacccc ggaggaggag caggctacca agcagtttct cgaagagatt aacaagtgga cagttcagta caatgtttcc ccgctgtctt ggaatgtggc tgtcaagttc ctcatggcaa ggaagtttga tgtgctccgt gccatagaat tgttccactc ctacagagaa actcgaagga aggaaggcat tgtaaagctg aaacctcatg aggaacctct tcgttctgag atcctcagtg gaaaattcac catcttaaat gttcgggacc caacaggagc ctccattgcc ctctttactg ccaggttgca tcatccccac aagtcagtcc aacatgtggt acttcaggct ctgttttact tgctagacag agctgtggat agctttgaaa ctcagaggaa tggactggtg tttatctatg acatgtgtgg ttctaattat gccaactttg agctggatct tggcaagaaa gtcctaaacc tgctgaaggg agcatttcca gctcgtttga agaaggtgct gattgtgggg gcacccatat ggttccgagt gccctattcc atcatcagtc tcctcctgaa ggacaaagtc cgggagagga ttcaaatatt aaagacatct gaggtcacgc agcatctgcc cagggagtgt cttccagaaa acctgggtgg gtacgtcaaa attgatctcg ccacttggaa tttccagttc ctaccccagg tgaacggcca cccagatccc ttcgatgaga tcatcctgtt ctccctccct cctgccttag actgggactc agtacatgtt ccaggtcccc atgctatgac catccaagag ttggtggact atgttaatgc caggcaaaag caaggaatct atgaggaata tgaagacatt cgtcgtgaga accctgttgg cactttccac tgttccatgt ctccaggaaa cctagagaaa aaccgttatg gggatgtacc ctgcctggac caaactagag tgaagctaac aaagcgaagt ggccatactc agacagatta catcaatgcc agtttcatgg atggctacaa gcagaagaat gcttacattg gcacacaagg tcctttggag aatacctatc gtgatttctg gctcatggta tgggagcaaa aagtcttggt gattgtcatg accacccgct ttgaggaagg cggcaggaga aagtgtggcc agtactggcc tttagaaaaa gactctcgga tccgatttgg cttcctcaca gtgaccaatc taggcgtgga gaacatgaat cattataaga aaacaacgct agaaattcac aacacagagg aacggcagaa acgccaggtg acccacttcc agttcttgag ctggccagac tatggtgtcc cttcctcagc agcttccctc attgacttct tgagagtggt cagaaaccag cagagtctgg ctgtgagcaa catgggagca cgctccaaag ggcagtgccc tgagccaccc attgtggtcc attgcagtgc aggcattggc aggacaggta ccttctgctc actggacatc tgcctggcac agctggagga gcttggcacc cttaatgtgt tccagacggt gtcacgcatg aggacccaga gggccttcag catccagacc cctgagcagt actatttttg ctacaaggcc atcctggagt tcgcagagaa ggagggcatg gtatcctctg gccaaaacct gctggccgtg gagagtcagt aa. It is sometimes possible for the material contained within the vial of "PTPN9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.