Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

RPL11 cdna clone

RPL11 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
RPL11; L11; DBA7; GIG34
Synonyms
RPL11; N/A; RPL11 cDNA Clone; RPL11 cdna clone
Ordering
Sequence
atggcggatcaaggtgaaaaggagaaccccatgcgggaacttcgcatccgcaaactctgtctcaacatctgtgttggggagagtggagacagactgacgcgagcagccaaggtgttggagcagctcacagggcagacccctgtgttttccaaagctagatacactgtcagatcctttggcatccggagaaatgaaaagattgctgtccactgcacagttcgaggggccaaggcagaagaaatcttggagaagggtctaaaggtgcgggagtatgagttaagaaaaaacaacttctcagatactggaaactttggttttgggatccaggaacacatcgatctgggtatcaaatatgacccaagcattggtatctacggcctggacttctatgtggtgctgggtaggccaggtttcagcatcgcagacaagaagcgcaggacaggctgcattggggccaaacacagaatcagcaaagaggaggccatgcgctggttccagcagaagtatgatgggatcatccttcctggcaaataa
Sequence Length
534
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,124 Da
NCBI Official Full Name
Homo sapiens ribosomal protein L11, mRNA
NCBI Official Synonym Full Names
ribosomal protein L11
NCBI Official Symbol
RPL11
NCBI Official Synonym Symbols
L11; DBA7; GIG34
NCBI Protein Information
60S ribosomal protein L11
UniProt Protein Name
60S ribosomal protein L11
UniProt Gene Name
RPL11
UniProt Entry Name
RL11_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The RPL11 rpl11 (Catalog #AAA116426) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatc aaggtgaaaa ggagaacccc atgcgggaac ttcgcatccg caaactctgt ctcaacatct gtgttgggga gagtggagac agactgacgc gagcagccaa ggtgttggag cagctcacag ggcagacccc tgtgttttcc aaagctagat acactgtcag atcctttggc atccggagaa atgaaaagat tgctgtccac tgcacagttc gaggggccaa ggcagaagaa atcttggaga agggtctaaa ggtgcgggag tatgagttaa gaaaaaacaa cttctcagat actggaaact ttggttttgg gatccaggaa cacatcgatc tgggtatcaa atatgaccca agcattggta tctacggcct ggacttctat gtggtgctgg gtaggccagg tttcagcatc gcagacaaga agcgcaggac aggctgcatt ggggccaaac acagaatcag caaagaggag gccatgcgct ggttccagca gaagtatgat gggatcatcc ttcctggcaa ataa. It is sometimes possible for the material contained within the vial of "RPL11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request Manual

Please complete the form below and a representative will contact you as soon as possible.

Request Quote

Please complete the form below and a representative will contact you as soon as possible.