RPS2 cdna clone
RPS2 cDNA Clone
Gene Names
RPS2; S2; LLREP3
Synonyms
RPS2; N/A; RPS2 cDNA Clone; RPS2 cdna clone
Sequence
atggcggatgacgccggtgcagcgggggggcccgggggccctggtggccctgggatggggaaccgcggtggcttccgcggaggtttcggcagtggcatccggggccggggtcgcggccgtggacggggccggggccgaggccgcggagctcgcggaggcaaggccgaggataaggagtggatgcccgtcaccaagttgggccgcttggtcaaggacatgaagatcaagtccctggaggagatctatctcttctccctgcccattaaggaatcagagatcattgatttcttcctgggggcctctctcaaggatgaggttttgaagattatgccagtgcagaagcagacccgtgccggccagcgcaccaggttcaaggcatttgttgctatcggggactacaatggccacgtcggtctgggtgttaagtgctccaaggaggtggccaccgccatccgtggggccatcatcctggccaagctctccatcgtccccgtgcgcagaggctactgggggaacaagatcggcaagccccacactgtcccttgcaaggtgacaggccgctgcggctctgtgctggtacgcctcatccctgcacccaggggcactggcatcgtctccgcacctgtgcctaagaagctgctcatgatggctggtatcgatgactgctacacctcagcccggggctgcactgccaccctgggcaacttcgccaaggccacctttgatgccatttcaaagacctacagctacctgacccccgacctctggaaggagactgtattcaccaagtctccctatcaggagttcactgaccacctcgtcaagacccacaccagagtctccgtgcagcggactcaggctccagctgtggctacaacatag
Sequence Length
882
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,324 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S2, mRNA
NCBI Official Synonym Full Names
ribosomal protein S2
NCBI Official Symbol
RPS2
NCBI Official Synonym Symbols
S2; LLREP3
NCBI Protein Information
40S ribosomal protein S2; OK/KNS-cl.6; protein LLRep3; 40S ribosomal protein S4
UniProt Protein Name
40S ribosomal protein S2
UniProt Gene Name
RPS2
UniProt Synonym Gene Names
RPS4
UniProt Entry Name
RS2_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The RPS2 rps2 (Catalog #AAA116385) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatg acgccggtgc agcggggggg cccgggggcc ctggtggccc tgggatgggg aaccgcggtg gcttccgcgg aggtttcggc agtggcatcc ggggccgggg tcgcggccgt ggacggggcc ggggccgagg ccgcggagct cgcggaggca aggccgagga taaggagtgg atgcccgtca ccaagttggg ccgcttggtc aaggacatga agatcaagtc cctggaggag atctatctct tctccctgcc cattaaggaa tcagagatca ttgatttctt cctgggggcc tctctcaagg atgaggtttt gaagattatg ccagtgcaga agcagacccg tgccggccag cgcaccaggt tcaaggcatt tgttgctatc ggggactaca atggccacgt cggtctgggt gttaagtgct ccaaggaggt ggccaccgcc atccgtgggg ccatcatcct ggccaagctc tccatcgtcc ccgtgcgcag aggctactgg gggaacaaga tcggcaagcc ccacactgtc ccttgcaagg tgacaggccg ctgcggctct gtgctggtac gcctcatccc tgcacccagg ggcactggca tcgtctccgc acctgtgcct aagaagctgc tcatgatggc tggtatcgat gactgctaca cctcagcccg gggctgcact gccaccctgg gcaacttcgc caaggccacc tttgatgcca tttcaaagac ctacagctac ctgacccccg acctctggaa ggagactgta ttcaccaagt ctccctatca ggagttcact gaccacctcg tcaagaccca caccagagtc tccgtgcagc ggactcaggc tccagctgtg gctacaacat ag. It is sometimes possible for the material contained within the vial of "RPS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.