Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

SCNN1G cdna clone

SCNN1G cDNA Clone

Gene Names
SCNN1G; PHA1; BESC3; ENaCg; SCNEG; ENaCgamma
Synonyms
SCNN1G; N/A; SCNN1G cDNA Clone; SCNN1G cdna clone
Ordering
Sequence
atggcacccggagagaagatcaaagccaaaatcaagaagaatctgcccgtgacgggccctcaggcgccgaccattaaagagctgatgcggtggtactgcctcaacaccaacacccatggctgtcgccgcatcgtggtgtcccgcggccgtctgcgccgcctcctctggatcgggttcacactgactgccgtggccctcatcctctggcagtgcgccctcctcgtcttctccttctatactgtctcagtttccatcaaagtccacttccggaagctggattttcctgcagtcaccatctgcaacatcaacccctacaagtacagcaccgttcgccaccttctagctgacttggaacaggagaccagagaggccctgaagtccctgtatggctttccagagtcccggaagcgccgagaggcggagtcctggaactccgtctcagagggaaagcagcctagattctcccaccggattccgctgctgatctttgatcaggatgagaagggcaaggccagggacttcttcacagggaggaagcggaaagtcggcggtagcatcattcacaaggcttcaaatgtcatgcacatcgagtccaagcaagtggtgggattccaactgtgctcaaatgacacctccgactgtgccacctacaccttcagctcgggaatcaatgccattcaggagtggtataagctacactacatgaacatcatggcacaggtgcctctggagaagaaaatcaacatgagctattctgctgaggagctgctggtgacctgcttctttgatggagtgtcctgtgatgccaggaatttcacgcttttccaccacccgatgcatgggaattgctatactttcaacaacagagaaaatgagaccattctcagcacctccatggggggcagcgaatatgggctgcaagtcattttgtacataaacgaagaggaatacaacccattcctcgtgtcctccactggagctaaggtgatcatccatcggcaggatgagtatcccttcgtcgaagatgtgggaacagagattgagacagcaatggtcacctctataggaatgcacctgacagagtccttcaagctgagtgagccctacagtcagtgcacggaggacgggagtgacgtgccaatcaggaacatctacaacgctgcctactcgctccagatctgccttcattcatgcttccagacaaagatggtggagaaatgtgggtgtgcccagtacagccagcctctacctcctgcagccaactactgcaactaccagcagcaccccaactggatgtattgttactaccaactgcatcgagcctttgtccaggaagagctgggctgccagtctgtgtgcaaggaagcctgcagctttaaagagtggacactaaccacaagcctggcacaatggccatctgtggtttcggagaagtggttgctgcctgttctcacttgggaccaaggccggcaagtaaacaaaaagctcaacaagacagacttggccaaactcttgatattctacaaagacctgaaccagagatccatcatggagagcccagccaacagtattgagatgcttctgtccaacttcggtggccagctgggcctgtggatgagctgctctgttgtctgcgtcatcgagatcatcgaggtcttcttcattgacttcttctctatcattgcccgccgccagtggcagaaagccaaggagtggtgggcctggaaacaggctcccccatgtccagaagctccccgtagcccacagggccaggacaatccagccctggatatagacgatgacctacccactttcaactctgctttgcacctgcctccagccctaggaacccaagtgcccggcacaccgccccccaaatacaataccttgcgcttggagagggccttttccaaccagctcacagatacccagatgctggatgagctctga
Sequence Length
1950
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,270 Da
NCBI Official Full Name
Homo sapiens sodium channel, nonvoltage-gated 1, gamma, mRNA
NCBI Official Synonym Full Names
sodium channel epithelial 1 gamma subunit
NCBI Official Symbol
SCNN1G
NCBI Official Synonym Symbols
PHA1; BESC3; ENaCg; SCNEG; ENaCgamma
NCBI Protein Information
amiloride-sensitive sodium channel subunit gamma
UniProt Protein Name
Amiloride-sensitive sodium channel subunit gamma
UniProt Gene Name
SCNN1G
UniProt Synonym Gene Names
ENaCG; Gamma-ENaC
UniProt Entry Name
SCNNG_HUMAN

Similar Products

Product Notes

The SCNN1G scnn1g (Catalog #AAA116409) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacccg gagagaagat caaagccaaa atcaagaaga atctgcccgt gacgggccct caggcgccga ccattaaaga gctgatgcgg tggtactgcc tcaacaccaa cacccatggc tgtcgccgca tcgtggtgtc ccgcggccgt ctgcgccgcc tcctctggat cgggttcaca ctgactgccg tggccctcat cctctggcag tgcgccctcc tcgtcttctc cttctatact gtctcagttt ccatcaaagt ccacttccgg aagctggatt ttcctgcagt caccatctgc aacatcaacc cctacaagta cagcaccgtt cgccaccttc tagctgactt ggaacaggag accagagagg ccctgaagtc cctgtatggc tttccagagt cccggaagcg ccgagaggcg gagtcctgga actccgtctc agagggaaag cagcctagat tctcccaccg gattccgctg ctgatctttg atcaggatga gaagggcaag gccagggact tcttcacagg gaggaagcgg aaagtcggcg gtagcatcat tcacaaggct tcaaatgtca tgcacatcga gtccaagcaa gtggtgggat tccaactgtg ctcaaatgac acctccgact gtgccaccta caccttcagc tcgggaatca atgccattca ggagtggtat aagctacact acatgaacat catggcacag gtgcctctgg agaagaaaat caacatgagc tattctgctg aggagctgct ggtgacctgc ttctttgatg gagtgtcctg tgatgccagg aatttcacgc ttttccacca cccgatgcat gggaattgct atactttcaa caacagagaa aatgagacca ttctcagcac ctccatgggg ggcagcgaat atgggctgca agtcattttg tacataaacg aagaggaata caacccattc ctcgtgtcct ccactggagc taaggtgatc atccatcggc aggatgagta tcccttcgtc gaagatgtgg gaacagagat tgagacagca atggtcacct ctataggaat gcacctgaca gagtccttca agctgagtga gccctacagt cagtgcacgg aggacgggag tgacgtgcca atcaggaaca tctacaacgc tgcctactcg ctccagatct gccttcattc atgcttccag acaaagatgg tggagaaatg tgggtgtgcc cagtacagcc agcctctacc tcctgcagcc aactactgca actaccagca gcaccccaac tggatgtatt gttactacca actgcatcga gcctttgtcc aggaagagct gggctgccag tctgtgtgca aggaagcctg cagctttaaa gagtggacac taaccacaag cctggcacaa tggccatctg tggtttcgga gaagtggttg ctgcctgttc tcacttggga ccaaggccgg caagtaaaca aaaagctcaa caagacagac ttggccaaac tcttgatatt ctacaaagac ctgaaccaga gatccatcat ggagagccca gccaacagta ttgagatgct tctgtccaac ttcggtggcc agctgggcct gtggatgagc tgctctgttg tctgcgtcat cgagatcatc gaggtcttct tcattgactt cttctctatc attgcccgcc gccagtggca gaaagccaag gagtggtggg cctggaaaca ggctccccca tgtccagaag ctccccgtag cccacagggc caggacaatc cagccctgga tatagacgat gacctaccca ctttcaactc tgctttgcac ctgcctccag ccctaggaac ccaagtgccc ggcacaccgc cccccaaata caataccttg cgcttggaga gggccttttc caaccagctc acagataccc agatgctgga tgagctctga. It is sometimes possible for the material contained within the vial of "SCNN1G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.