SETBP1 cdna clone
SETBP1 cDNA Clone
Gene Names
SETBP1; SEB; MRD29
Synonyms
SETBP1; N/A; SETBP1 cDNA Clone; SETBP1 cdna clone
Sequence
atggagtccagggaaaccttaagcagctcccggcaaagagggggcgagtcagacttcctgccggtctcctcagccaagcccccagctgctcctggctgtgcaggagaacctttgctctccactccaggacctgggaaggggatcccggtgggcggagagcgcatggagccagaggaggaggatgaactaggctcagggcgggatgtggattccaactccaacgcggacagtgagaaatgggtggcaggagatggtttggaagagcaggaattttctatcaaggaggcaaacttcacagagggaagtctgaagctaaagattcagaccacaaagcgggctaagaaacccccaaagaatttggagaactatatatgtccacctgagatcaagatcaccatcaagcagtctggggaccagaaggtgtcccgtgctggaaaaaatagcaaagccacgaaggaggaagaaagaagccactccaaaaagaagctcctcacagccagtgaccttgcagccagtgacctcaaaggatttcagccacagattaaagactccagtaaggaggaagtctggaagagaagaggaggccaaggcatcccattcaaaaagcaattcctgtcccaggaacgtgccatgtgcttctcatgcccccggaacccattccccgcaaaacccggttctctcactcttccttttcacagtgaacctgcagtctgggcacaagaagtataa
Sequence Length
729
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Preparation and Storage
It will be shipped on blue ice. The storage period and condition: 4 degree C, 6 months, -20 degree C 2-3 years, -80 degree C Long-term storage
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,397 Da
NCBI Official Full Name
Homo sapiens SET binding protein 1, mRNA
NCBI Official Synonym Full Names
SET binding protein 1
NCBI Official Symbol
SETBP1
NCBI Official Synonym Symbols
SEB; MRD29
NCBI Protein Information
SET-binding protein
UniProt Protein Name
SET-binding protein
UniProt Gene Name
SETBP1
UniProt Synonym Gene Names
KIAA0437; SEB
UniProt Entry Name
SETBP_HUMAN
Similar Products
Product Notes
The SETBP1 setbp1 (Catalog #AAA116354) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcca gggaaacctt aagcagctcc cggcaaagag ggggcgagtc agacttcctg ccggtctcct cagccaagcc cccagctgct cctggctgtg caggagaacc tttgctctcc actccaggac ctgggaaggg gatcccggtg ggcggagagc gcatggagcc agaggaggag gatgaactag gctcagggcg ggatgtggat tccaactcca acgcggacag tgagaaatgg gtggcaggag atggtttgga agagcaggaa ttttctatca aggaggcaaa cttcacagag ggaagtctga agctaaagat tcagaccaca aagcgggcta agaaaccccc aaagaatttg gagaactata tatgtccacc tgagatcaag atcaccatca agcagtctgg ggaccagaag gtgtcccgtg ctggaaaaaa tagcaaagcc acgaaggagg aagaaagaag ccactccaaa aagaagctcc tcacagccag tgaccttgca gccagtgacc tcaaaggatt tcagccacag attaaagact ccagtaagga ggaagtctgg aagagaagag gaggccaagg catcccattc aaaaagcaat tcctgtccca ggaacgtgcc atgtgcttct catgcccccg gaacccattc cccgcaaaac ccggttctct cactcttcct tttcacagtg aacctgcagt ctgggcacaa gaagtataa. It is sometimes possible for the material contained within the vial of "SETBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.