Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

SLC23A2 cdna clone

SLC23A2 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
SLC23A2; NBTL1; SVCT2; YSPL2; hSVCT2; SLC23A1
Synonyms
SLC23A2; N/A; SLC23A2 cDNA Clone; SLC23A2 cdna clone
Ordering
Sequence
atgatgggtattggtaagaataccacatccaaatcaatggaggctggaagttcaacagaaggcaaatacgaagacgaggcaaagcacccagctttcttcactcttccggtggtgataaatggaggcgccacctccagcggtgagcaggacaatgaggacactgagctcatggcgatctacactacggaaaacggcattgcagaaaagagctctctcgctgagaccctggatagcactggcagtctggacccccagcgatcagacatgatttataccatagaagatgttcctccctggtacctgtgtatatttctggggctacagcactacctgacatgcttcagcggcacgatcgcagtgcccttcctgttggccgatgccatgtgtgtggggtacgaccagtgggccaccagccagctcattgggaccattttcttctgtgtgggaatcactactttgctacagacaacgtttggatgcaggttacccctgtttcaggccagtgcttttgcatttttggcccctgctcgagccatcctgtctttagataaatggaaatgtaacaccacagatgtttcagttgccaatggaacagcagagctgttgcacacagaacacatctggtatccccggatccgagagatccagggggccatcatcatgtcctcactgatagaagtagtcatcggcctcctcggcctgcctggggctctactgaagtacatcggtcccttgaccattacacccacggtggccctaattggcctctctggtttccaggcagcgggggagagagccgggaagcactggggcattgccatgctgacaatattcctagtattactgttttctcaatacgccagaaatgttaaatttcctctcccgatttataaatccaagaaaggatggactgcgtacaagttacagctgttcaaaatgttccctatcatcctggccatcctggtatcctggctgctctgcttcatcttcacggtgacagacgtcttccctcccgacagcacaaagtatggcttctatgctcgcacagatgccaggcaaggcgtgcttctggtagccccgtggtttaaggttccatacccatttcagtggggactgcccaccgtgtctgcggccggtgtcatcggcatgctcagtgccgtggtcgccagcatcatcgagtctattggtgactactacgcctgtgcacggctgtcctgtgccccacccccccccatccacgcaataaacaggtacgttcctgagaagacaagttcctga
Sequence Length
1278
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,177 Da
NCBI Official Full Name
Homo sapiens solute carrier family 23 (nucleobase transporters), member 2, mRNA
NCBI Official Synonym Full Names
solute carrier family 23 member 2
NCBI Official Symbol
SLC23A2
NCBI Official Synonym Symbols
NBTL1; SVCT2; YSPL2; hSVCT2; SLC23A1
NCBI Protein Information
solute carrier family 23 member 2
UniProt Protein Name
Solute carrier family 23 member 2
UniProt Gene Name
SLC23A2
UniProt Synonym Gene Names
KIAA0238; NBTL1; SLC23A1; SVCT2; YSPL2; hSVCT2
UniProt Entry Name
S23A2_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The SLC23A2 slc23a2 (Catalog #AAA116406) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgggta ttggtaagaa taccacatcc aaatcaatgg aggctggaag ttcaacagaa ggcaaatacg aagacgaggc aaagcaccca gctttcttca ctcttccggt ggtgataaat ggaggcgcca cctccagcgg tgagcaggac aatgaggaca ctgagctcat ggcgatctac actacggaaa acggcattgc agaaaagagc tctctcgctg agaccctgga tagcactggc agtctggacc cccagcgatc agacatgatt tataccatag aagatgttcc tccctggtac ctgtgtatat ttctggggct acagcactac ctgacatgct tcagcggcac gatcgcagtg cccttcctgt tggccgatgc catgtgtgtg gggtacgacc agtgggccac cagccagctc attgggacca ttttcttctg tgtgggaatc actactttgc tacagacaac gtttggatgc aggttacccc tgtttcaggc cagtgctttt gcatttttgg cccctgctcg agccatcctg tctttagata aatggaaatg taacaccaca gatgtttcag ttgccaatgg aacagcagag ctgttgcaca cagaacacat ctggtatccc cggatccgag agatccaggg ggccatcatc atgtcctcac tgatagaagt agtcatcggc ctcctcggcc tgcctggggc tctactgaag tacatcggtc ccttgaccat tacacccacg gtggccctaa ttggcctctc tggtttccag gcagcggggg agagagccgg gaagcactgg ggcattgcca tgctgacaat attcctagta ttactgtttt ctcaatacgc cagaaatgtt aaatttcctc tcccgattta taaatccaag aaaggatgga ctgcgtacaa gttacagctg ttcaaaatgt tccctatcat cctggccatc ctggtatcct ggctgctctg cttcatcttc acggtgacag acgtcttccc tcccgacagc acaaagtatg gcttctatgc tcgcacagat gccaggcaag gcgtgcttct ggtagccccg tggtttaagg ttccataccc atttcagtgg ggactgccca ccgtgtctgc ggccggtgtc atcggcatgc tcagtgccgt ggtcgccagc atcatcgagt ctattggtga ctactacgcc tgtgcacggc tgtcctgtgc cccacccccc cccatccacg caataaacag gtacgttcct gagaagacaa gttcctga. It is sometimes possible for the material contained within the vial of "SLC23A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.