SLC25A27 cDNA Clone – Homo Sapiens Solute Carrier Family 25, Member 27, Mrna
SLC25A27 cDNA Clone
Gene Names
SLC25A27; UCP4
Synonyms
SLC25A27; N/A; SLC25A27 cDNA Clone; SLC25A27 cdna clone
Product Overview
Sequence
atgtccgtcccggaggaggaggagaggcttttgccgctgacccagagatggccccgagcgagcaaattcctactgtccggctgcgcggctaccgtggccgagctagcaacctttcccctggatctcacaaaaactcgactccaaatgcaaggagaagcagctcttgctcggttgggagacggtgcaagagaatctgccccctataggggaatggtgcgcacagccctagggatcattgaagaggaaggctttctaaagctttggcaaggagtgacacccgccatttacagacacgtagtgtattctggaggtcgaatggtcacatatgaacatctccgagaggttgtgtttggcaaaagtgaagatgagcattatcccctttggaaatcagtcattggagggatgatggctggtgttattggccagtttttagtcaatccaactgacctagtgaaggttcagatgcaaatggaaggaaaaaggaaactggaaggaaaaccattgcgatttcgtggtgtacatcatgcatttgcaaaaatcttagctgaaggaggaatacgagggctttgggcaggctgggtacccaatatacaaagagcagcactggtgaatatgggagatttaaccacttatgatacagtgaaacactacttggtattgaatacaccacttgaggacaatatcatgactcacggtttatcaagtgatctggtcggatctcacaaggccatccaatga
Sequence Length
738
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,210 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25, member 27, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 27
NCBI Official Symbol
SLC25A27
NCBI Official Synonym Symbols
UCP4
NCBI Protein Information
mitochondrial uncoupling protein 4
UniProt Protein Name
Mitochondrial uncoupling protein 4
UniProt Gene Name
SLC25A27
UniProt Synonym Gene Names
UCP4; UCP 4
UniProt Entry Name
UCP4_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The SLC25A27 slc25a27 (Catalog #AAA116333) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgtcc cggaggagga ggagaggctt ttgccgctga cccagagatg gccccgagcg agcaaattcc tactgtccgg ctgcgcggct accgtggccg agctagcaac ctttcccctg gatctcacaa aaactcgact ccaaatgcaa ggagaagcag ctcttgctcg gttgggagac ggtgcaagag aatctgcccc ctatagggga atggtgcgca cagccctagg gatcattgaa gaggaaggct ttctaaagct ttggcaagga gtgacacccg ccatttacag acacgtagtg tattctggag gtcgaatggt cacatatgaa catctccgag aggttgtgtt tggcaaaagt gaagatgagc attatcccct ttggaaatca gtcattggag ggatgatggc tggtgttatt ggccagtttt tagtcaatcc aactgaccta gtgaaggttc agatgcaaat ggaaggaaaa aggaaactgg aaggaaaacc attgcgattt cgtggtgtac atcatgcatt tgcaaaaatc ttagctgaag gaggaatacg agggctttgg gcaggctggg tacccaatat acaaagagca gcactggtga atatgggaga tttaaccact tatgatacag tgaaacacta cttggtattg aatacaccac ttgaggacaa tatcatgact cacggtttat caagtgatct ggtcggatct cacaaggcca tccaatga. It is sometimes possible for the material contained within the vial of "SLC25A27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.