Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

SLC47A1 cdna clone

SLC47A1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
SLC47A1; MATE1
Synonyms
SLC47A1; N/A; SLC47A1 cDNA Clone; MATE1; SLC47A1 cdna clone
Ordering
Sequence
atggaagctcctgaggagcccgcgccagtgcgcggaggcccggaggccacccttgaggtccgtgggtcgcgctgcttgcggctgtccgccttccgagaagagctgcgggcgctcttggtcctggctggccccgcgttcttggttcagctgatggtgttcctgatcagcttcataagctccgtgttctgtggccacctgggcaagctggagctggatgcagtcacgctggcaatcgcggttatcaatgtcactggtgtctcagtgggattcggcttatcttctgcctgtgacaccctcatctcccagacgtacgggagccagaacctgaagcacgtgggcgtgatcctgcagcggagtgcgctcgtcctgctcctctgctgcttcccctgctgggcgctctttctcaacacccagcacatcctgctgctcttcaggcaggacccagatgtgtccaggcttacccagacctatgtcacgatcttcattccagctcttcctgcaacctttctttatatgttacaagttaaatatttgctcaaccagggaattgtactgccccagatcgtaactggagttgcagccaaccttgtcaatgccctcgccaactatctgtttctccatcaactgcatcttggggtgataggctctgcactggcaaacttgatttcccagtacaccctggctctactcctctttctctacatcctcgggaaaaaactgcatcaagctacatggggaggctggtccctcgagtgcctgcaggactgggcctccttcctccgcctggccatccccagcatgctcatgctgtgcatggagtggtgggcctatgaggtcgggagcttcctcagtggtctgtatgaggatggatga
Sequence Length
873
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for SLC47A1 cdna clone
Homo sapiens solute carrier family 47, member 1, mRNA (cDNA clone MGC:64822 IMAGE:5188651, complete cds.

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
61,922 Da
NCBI Official Full Name
Homo sapiens solute carrier family 47, member 1, mRNA
NCBI Official Synonym Full Names
solute carrier family 47, member 1
NCBI Official Symbol
SLC47A1
NCBI Official Synonym Symbols
MATE1
NCBI Protein Information
multidrug and toxin extrusion protein 1; MATE-1; hMATE-1; multidrug and toxin extrusion 1
UniProt Protein Name
Multidrug and toxin extrusion protein 1
UniProt Gene Name
SLC47A1
UniProt Synonym Gene Names
MATE1; MATE-1; hMATE-1
UniProt Entry Name
S47A1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The SLC47A1 slc47a1 (Catalog #AAA116484) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagctc ctgaggagcc cgcgccagtg cgcggaggcc cggaggccac ccttgaggtc cgtgggtcgc gctgcttgcg gctgtccgcc ttccgagaag agctgcgggc gctcttggtc ctggctggcc ccgcgttctt ggttcagctg atggtgttcc tgatcagctt cataagctcc gtgttctgtg gccacctggg caagctggag ctggatgcag tcacgctggc aatcgcggtt atcaatgtca ctggtgtctc agtgggattc ggcttatctt ctgcctgtga caccctcatc tcccagacgt acgggagcca gaacctgaag cacgtgggcg tgatcctgca gcggagtgcg ctcgtcctgc tcctctgctg cttcccctgc tgggcgctct ttctcaacac ccagcacatc ctgctgctct tcaggcagga cccagatgtg tccaggctta cccagaccta tgtcacgatc ttcattccag ctcttcctgc aacctttctt tatatgttac aagttaaata tttgctcaac cagggaattg tactgcccca gatcgtaact ggagttgcag ccaaccttgt caatgccctc gccaactatc tgtttctcca tcaactgcat cttggggtga taggctctgc actggcaaac ttgatttccc agtacaccct ggctctactc ctctttctct acatcctcgg gaaaaaactg catcaagcta catggggagg ctggtccctc gagtgcctgc aggactgggc ctccttcctc cgcctggcca tccccagcat gctcatgctg tgcatggagt ggtgggccta tgaggtcggg agcttcctca gtggtctgta tgaggatgga tga. It is sometimes possible for the material contained within the vial of "SLC47A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.