SNRPB2 cdna clone
SNRPB2 cDNA Clone
Gene Names
SNRPB2; Msl1; U2B''
Synonyms
SNRPB2; N/A; SNRPB2 cDNA Clone; SNRPB2 cdna clone
Sequence
atggatatcagaccaaatcatacaatttatatcaacaatatgaatgacaaaattaaaaaggaagaattgaagagatccctatatgccctgttttctcagtttggtcatgtggtggacattgtggctttaaagaccatgaagatgagggggcaggcctttgtcatatttaaggaactgggctcatccacaaatgccttgagacagctacaaggatttccattttatggtaaaccaatgcgaatacagtatgcaaaaacagattcggatataatatcaaaaatgcgtggaacttttgctgacaaagaaaagaaaaaagaaaagaaaaaagccaaaactgtggaacagactgcaacaaccacaaacaaaaagcctggccagggaactccaaattcagctaatacccaaggaaattcaacaccaaatcctcaggtccctgattaccctccaaactatattttattccttaataacttaccagaagagactaatgagatgatgttatccatgctgtttaatcagttccctggcttcaaggaagtacgtctggtaccagggaggcatgacattgcttttgttgaatttgaaaatgatgggcaggctggagctgccagggatgctttacagggatttaagatcacaccgtcccatgctatgaagatcacctatgccaagaaataa
Sequence Length
678
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,486 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein polypeptide B'', mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein polypeptide B2
NCBI Official Symbol
SNRPB2
NCBI Official Synonym Symbols
Msl1; U2B''
NCBI Protein Information
U2 small nuclear ribonucleoprotein B''
UniProt Protein Name
U2 small nuclear ribonucleoprotein B''
UniProt Gene Name
SNRPB2
UniProt Synonym Gene Names
U2 snRNP B''
UniProt Entry Name
RU2B_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The SNRPB2 snrpb2 (Catalog #AAA116329) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatatca gaccaaatca tacaatttat atcaacaata tgaatgacaa aattaaaaag gaagaattga agagatccct atatgccctg ttttctcagt ttggtcatgt ggtggacatt gtggctttaa agaccatgaa gatgaggggg caggcctttg tcatatttaa ggaactgggc tcatccacaa atgccttgag acagctacaa ggatttccat tttatggtaa accaatgcga atacagtatg caaaaacaga ttcggatata atatcaaaaa tgcgtggaac ttttgctgac aaagaaaaga aaaaagaaaa gaaaaaagcc aaaactgtgg aacagactgc aacaaccaca aacaaaaagc ctggccaggg aactccaaat tcagctaata cccaaggaaa ttcaacacca aatcctcagg tccctgatta ccctccaaac tatattttat tccttaataa cttaccagaa gagactaatg agatgatgtt atccatgctg tttaatcagt tccctggctt caaggaagta cgtctggtac cagggaggca tgacattgct tttgttgaat ttgaaaatga tgggcaggct ggagctgcca gggatgcttt acagggattt aagatcacac cgtcccatgc tatgaagatc acctatgcca agaaataa. It is sometimes possible for the material contained within the vial of "SNRPB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.