Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

SNX1 cdna clone

SNX1 cDNA Clone

Gene Names
SNX1; VPS5; HsT17379
Synonyms
SNX1; N/A; SNX1 cDNA Clone; SNX1 cdna clone
Ordering
Sequence
atggcgtcgggtggtggtggctgtagcgcttcggagagactgcctccgcccttccccggcctggagccggagtccgagggggcggccgggggatcagaacccgaggctggggacagcgacaccgagggggaggacattttcaccggcgccgcggtggtcagtaaacatcagtctccaaagataactacatcccttcttcccatcaacaatggctccaaagaaaatgggatccatgaagaacaagaccaagagccacaggatctctttgcagatgccacagtggagctatccttggacagcacacaaaataatcagaagaaggtgctagccaaaacactcatttctcttcctcctcaggaagccacaaattcttcgaagccccagccaacctatgaggagctagaggaagaagaacaggaggatcaatttgatttgacagtcggtataactgatcctgagaagataggggatggtatgaatgcatatgtagcctacaaagttacaacacagacaagcttaccattgttcagaagcaaacagtttgcagtaaaaagaagatttagtgactttctgggtctttatgagaagctttccgagaagcactctcagaatggcttcattgtccctccacccccggagaagagcctcatagggatgacaaaagtgaaagttgggaaggaagattcttcttctgcagaatttcttgaaaaacggagggccgctttagaaaggtaccttcagaggattgtaaatcatcctaccatgttacaggaccctgacgtcagagagttcttggaaaaagaagagctgccacgtgccgtgggtacccagacattgagtggtgctggtctcctcaagatgttcaacaaagccacagatgccgtcagcaaaatgaccatcaagatgaatgaatcagacatttggtttgaggagaagctccaggaggtagagtgtgaggagcagcgcttacggaaactgcatgctgttgtagaaactctagtcaaccataggaaagagctagcgctgaacacagcccagtttgcaaagagtctagccatgcttgggagctctgaggacaacacggcattgtcacgggcactctcccagctggctgaggtggaagaaaaaattgagcagctccaccaggaacaggccaacaatgacttcttcctccttgctgagctcctgagtgactacattcgcctcctggccatagtccgcgctgccttcgaccagcgcatgaagacatggcagcgctggcaggatgcccaagccacactgcagaagaagcgggaggccgaggctcggctgctgtgggccaacaagcctgataagctgcagcaggccaaggacgagatcctcgagtgggagtctcgggtgactcaatatgaaagggacttcgagaggatttcaacagtggtccgaaaagaagtgatacggtttgagaaagagaaatccaaggacttcaagaaccacgtgatcaagtaccttgagacactcctttactcacagcagcagctggcaaagtactgggaagccttccttcctgaggcaaaggccatctcctaa
Sequence Length
1569
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,082 Da
NCBI Official Full Name
Homo sapiens sorting nexin 1, mRNA
NCBI Official Synonym Full Names
sorting nexin 1
NCBI Official Symbol
SNX1
NCBI Official Synonym Symbols
VPS5; HsT17379
NCBI Protein Information
sorting nexin-1
UniProt Protein Name
Sorting nexin-1
UniProt Gene Name
SNX1
UniProt Entry Name
SNX1_HUMAN

Similar Products

Product Notes

The SNX1 snx1 (Catalog #AAA116413) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcgg gtggtggtgg ctgtagcgct tcggagagac tgcctccgcc cttccccggc ctggagccgg agtccgaggg ggcggccggg ggatcagaac ccgaggctgg ggacagcgac accgaggggg aggacatttt caccggcgcc gcggtggtca gtaaacatca gtctccaaag ataactacat cccttcttcc catcaacaat ggctccaaag aaaatgggat ccatgaagaa caagaccaag agccacagga tctctttgca gatgccacag tggagctatc cttggacagc acacaaaata atcagaagaa ggtgctagcc aaaacactca tttctcttcc tcctcaggaa gccacaaatt cttcgaagcc ccagccaacc tatgaggagc tagaggaaga agaacaggag gatcaatttg atttgacagt cggtataact gatcctgaga agatagggga tggtatgaat gcatatgtag cctacaaagt tacaacacag acaagcttac cattgttcag aagcaaacag tttgcagtaa aaagaagatt tagtgacttt ctgggtcttt atgagaagct ttccgagaag cactctcaga atggcttcat tgtccctcca cccccggaga agagcctcat agggatgaca aaagtgaaag ttgggaagga agattcttct tctgcagaat ttcttgaaaa acggagggcc gctttagaaa ggtaccttca gaggattgta aatcatccta ccatgttaca ggaccctgac gtcagagagt tcttggaaaa agaagagctg ccacgtgccg tgggtaccca gacattgagt ggtgctggtc tcctcaagat gttcaacaaa gccacagatg ccgtcagcaa aatgaccatc aagatgaatg aatcagacat ttggtttgag gagaagctcc aggaggtaga gtgtgaggag cagcgcttac ggaaactgca tgctgttgta gaaactctag tcaaccatag gaaagagcta gcgctgaaca cagcccagtt tgcaaagagt ctagccatgc ttgggagctc tgaggacaac acggcattgt cacgggcact ctcccagctg gctgaggtgg aagaaaaaat tgagcagctc caccaggaac aggccaacaa tgacttcttc ctccttgctg agctcctgag tgactacatt cgcctcctgg ccatagtccg cgctgccttc gaccagcgca tgaagacatg gcagcgctgg caggatgccc aagccacact gcagaagaag cgggaggccg aggctcggct gctgtgggcc aacaagcctg ataagctgca gcaggccaag gacgagatcc tcgagtggga gtctcgggtg actcaatatg aaagggactt cgagaggatt tcaacagtgg tccgaaaaga agtgatacgg tttgagaaag agaaatccaa ggacttcaag aaccacgtga tcaagtacct tgagacactc ctttactcac agcagcagct ggcaaagtac tgggaagcct tccttcctga ggcaaaggcc atctcctaa. It is sometimes possible for the material contained within the vial of "SNX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.