SPATA2 cdna clone
SPATA2 cDNA Clone
Gene Names
SPATA2; PD1; tamo; PPP1R145
Synonyms
SPATA2; N/A; SPATA2 cDNA Clone; SPATA2 cdna clone
Sequence
atggggaagcccagttcaatggatactaaattcaaggatgacttatttcggaagtacgtgcagttccatgagagcaaagtggataccaccaccagcaggcagcggcctggcagcgatgagtgcctgcgggtggcagcctcaaccctgctcagcctgcacaaggtggatcccttttatcgattccggctgatccagttctatgaggtggtggagagctccttgcgctcgctcagctcctctagcctgcgggctctgcacggcgccttcagcatgctggagacggtgggcatcaacctcttcctctacccgtggaagaaggaattcagaagcatcaagacctacacgggcccttttgtttattatgtcaagtcgacattactggaagaggacatccgagccatcctgagctgcatgggctacacacctgagctgggcactgcatacaagctcagagagctcgtggagaccctccaggtgaagatggtctcctttgagctctttctggccaaagtcgagtgtgagcagatgctagaaatccactcacaagtgaaggacaagggctactccgagctggacattgtgagcgagcgcaagagcagtgcagaggatgtgcgcggctgctcggacgccctgcggcggcgggcagagggccgggagcacctgacggcctccatgtcacgagtggcactccagaagtcggccagcgagcgggcggccaaggactactacaagccccgcgtgaccaagccctcgaggtcagtggatgcctatgacagctactgggagagccggaagccacccctgaaggcctcattgagtcttcggaaggagcctgtggcaacggatgtgggggacgacctcaaggatgagatcatccgcccatccccttcgctgctgaccatggccagctccccccacggcagcccggatgtgcttccacccgcctcccccagcaacggcccggccctgctgcgcggtacctacttctccactcaggatgacgtggatctgtacacagactctgaacccagggccacctaccgtcggcaggatgctctgcggccggatgtgtggctgctcagaaacgatgcccactccctctaccacaagcgctcgccccctgccaaagagtccgccctctccaagtgccaaagctgcgggctgtcctgcagctcctccctctgccagcgctgtgacagcctgctcacctgtcctccagcttccaagcccagcgccttccccagcaaggcctcgactcatgacagcctggcccacggggcatctctgcgggagaagtacccaggccagactcagggcctcgaccgcctcccgcaccttcactccaaatccaagccctccaccacgcccacttcccgctgtggcttctgcaaccgcccaggcgccaccaacacctgcacccagtgttcaaaagtctcatgtgacgcctgcctcagcgcttaccattatgacccctgctacaaaaagagtgagctgcacaagttcatgcccaacaaccagctgaactacaagtccacccagctctcccatctcgtgtacagatag
Sequence Length
1563
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
58,427 Da
NCBI Official Full Name
Homo sapiens spermatogenesis associated 2, mRNA
NCBI Official Synonym Full Names
spermatogenesis associated 2
NCBI Official Symbol
SPATA2
NCBI Official Synonym Symbols
PD1; tamo; PPP1R145
NCBI Protein Information
spermatogenesis-associated protein 2
UniProt Protein Name
Spermatogenesis-associated protein 2
UniProt Gene Name
SPATA2
UniProt Synonym Gene Names
KIAA0757; PD1
UniProt Entry Name
SPAT2_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The SPATA2 spata2 (Catalog #AAA116350) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaagc ccagttcaat ggatactaaa ttcaaggatg acttatttcg gaagtacgtg cagttccatg agagcaaagt ggataccacc accagcaggc agcggcctgg cagcgatgag tgcctgcggg tggcagcctc aaccctgctc agcctgcaca aggtggatcc cttttatcga ttccggctga tccagttcta tgaggtggtg gagagctcct tgcgctcgct cagctcctct agcctgcggg ctctgcacgg cgccttcagc atgctggaga cggtgggcat caacctcttc ctctacccgt ggaagaagga attcagaagc atcaagacct acacgggccc ttttgtttat tatgtcaagt cgacattact ggaagaggac atccgagcca tcctgagctg catgggctac acacctgagc tgggcactgc atacaagctc agagagctcg tggagaccct ccaggtgaag atggtctcct ttgagctctt tctggccaaa gtcgagtgtg agcagatgct agaaatccac tcacaagtga aggacaaggg ctactccgag ctggacattg tgagcgagcg caagagcagt gcagaggatg tgcgcggctg ctcggacgcc ctgcggcggc gggcagaggg ccgggagcac ctgacggcct ccatgtcacg agtggcactc cagaagtcgg ccagcgagcg ggcggccaag gactactaca agccccgcgt gaccaagccc tcgaggtcag tggatgccta tgacagctac tgggagagcc ggaagccacc cctgaaggcc tcattgagtc ttcggaagga gcctgtggca acggatgtgg gggacgacct caaggatgag atcatccgcc catccccttc gctgctgacc atggccagct ccccccacgg cagcccggat gtgcttccac ccgcctcccc cagcaacggc ccggccctgc tgcgcggtac ctacttctcc actcaggatg acgtggatct gtacacagac tctgaaccca gggccaccta ccgtcggcag gatgctctgc ggccggatgt gtggctgctc agaaacgatg cccactccct ctaccacaag cgctcgcccc ctgccaaaga gtccgccctc tccaagtgcc aaagctgcgg gctgtcctgc agctcctccc tctgccagcg ctgtgacagc ctgctcacct gtcctccagc ttccaagccc agcgccttcc ccagcaaggc ctcgactcat gacagcctgg cccacggggc atctctgcgg gagaagtacc caggccagac tcagggcctc gaccgcctcc cgcaccttca ctccaaatcc aagccctcca ccacgcccac ttcccgctgt ggcttctgca accgcccagg cgccaccaac acctgcaccc agtgttcaaa agtctcatgt gacgcctgcc tcagcgctta ccattatgac ccctgctaca aaaagagtga gctgcacaag ttcatgccca acaaccagct gaactacaag tccacccagc tctcccatct cgtgtacaga tag. It is sometimes possible for the material contained within the vial of "SPATA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.