STARD3 cdna clone
STARD3 cDNA Clone
Gene Names
STARD3; CAB1; es64; MLN64
Synonyms
STARD3; N/A; STARD3 cDNA Clone; STARD3 cdna clone
Sequence
atgagcaagctgcccagggagctgacccgagacttggagcgcagcctgcctgccgtggcctccctgggctcctcactgtcccacagccagagcctctcctcgcacctccttccgccgcctgagaagcgaagggccatctctgatgtccgccgcaccttctgtctcttcgtcaccttcgacctgctcttcatctccctgctctggatcatcgaactgaataccaacacaggcatccgtaagaacttggagcaggagatcatccagtacaactttaaaacttccttcttcgacatctttgtcctggccttcttccgcttctctggactgctcctaggctatgccgtgctgcggctccggcactggtgggtgattgcggtcacgacgctggtgtccagtgcattcctcattgtcaaggtcatcctctctgagctgctcagcaaaggggcatttggctacctgctccccatcgtctcttttgtcctcgcctggttggagacctggttccttgacttcaaagtcctaccccaggaagctgaagaggagcgatggtatcttgccgcccaggttgctgttgcccgtggacccctgctgttctccggtgctctgtccgagggacagttctattcacccccagaatcctttgcagggtctgacaatgaatcagatgaagaagttgctgggaagaaaagtttctctgctcaggagcgggagtacatccgccaggggaaggaggccacggcagtggtggaccagatcttggcccaggaagagaactggaagtttgagaagaataatgaatatggggacaccgtgtacaccattgaagttccctttcacggcaagacgtttatcctgaagaccttcctgccctgtcctgcggagctcgtgtaccaggaggtgatcctgcagcccgagaggatggtgctgtggaacaagacagtgactgcctgccagatcctgcagcgagtggaagacaacaccctcatctcctatgacgtgtctgcaggggctgcgggcggcgtggtctccccaagggacttcgtgaatgtccggcgcattgagcggcgcagggaccgatacttgtcatcagggatcgccacctcacacagtgccaagcccccgacgcacaaatatgtccggggagagaatggccctgggggcttcatcgtgctcaagtcggccagtaacccccgtgtttgcacctttgtctggattcttaatacagatctcaagggccgcctgccccggtacctcatccaccagagcctcgcggccaccatgtttgaatttgcctttcacctgcgacagcgcatcagcgagctgggggcccgggcgtga
Sequence Length
1338
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,960 Da
NCBI Official Full Name
Homo sapiens StAR-related lipid transfer (START) domain containing 3, mRNA
NCBI Official Synonym Full Names
StAR related lipid transfer domain containing 3
NCBI Official Symbol
STARD3
NCBI Official Synonym Symbols
CAB1; es64; MLN64
NCBI Protein Information
stAR-related lipid transfer protein 3
UniProt Protein Name
StAR-related lipid transfer protein 3
UniProt Gene Name
STARD3
UniProt Synonym Gene Names
CAB1; MLN64; MLN 64; StARD3
UniProt Entry Name
STAR3_HUMAN
Similar Products
Product Notes
The STARD3 stard3 (Catalog #AAA116396) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaagc tgcccaggga gctgacccga gacttggagc gcagcctgcc tgccgtggcc tccctgggct cctcactgtc ccacagccag agcctctcct cgcacctcct tccgccgcct gagaagcgaa gggccatctc tgatgtccgc cgcaccttct gtctcttcgt caccttcgac ctgctcttca tctccctgct ctggatcatc gaactgaata ccaacacagg catccgtaag aacttggagc aggagatcat ccagtacaac tttaaaactt ccttcttcga catctttgtc ctggccttct tccgcttctc tggactgctc ctaggctatg ccgtgctgcg gctccggcac tggtgggtga ttgcggtcac gacgctggtg tccagtgcat tcctcattgt caaggtcatc ctctctgagc tgctcagcaa aggggcattt ggctacctgc tccccatcgt ctcttttgtc ctcgcctggt tggagacctg gttccttgac ttcaaagtcc taccccagga agctgaagag gagcgatggt atcttgccgc ccaggttgct gttgcccgtg gacccctgct gttctccggt gctctgtccg agggacagtt ctattcaccc ccagaatcct ttgcagggtc tgacaatgaa tcagatgaag aagttgctgg gaagaaaagt ttctctgctc aggagcggga gtacatccgc caggggaagg aggccacggc agtggtggac cagatcttgg cccaggaaga gaactggaag tttgagaaga ataatgaata tggggacacc gtgtacacca ttgaagttcc ctttcacggc aagacgttta tcctgaagac cttcctgccc tgtcctgcgg agctcgtgta ccaggaggtg atcctgcagc ccgagaggat ggtgctgtgg aacaagacag tgactgcctg ccagatcctg cagcgagtgg aagacaacac cctcatctcc tatgacgtgt ctgcaggggc tgcgggcggc gtggtctccc caagggactt cgtgaatgtc cggcgcattg agcggcgcag ggaccgatac ttgtcatcag ggatcgccac ctcacacagt gccaagcccc cgacgcacaa atatgtccgg ggagagaatg gccctggggg cttcatcgtg ctcaagtcgg ccagtaaccc ccgtgtttgc acctttgtct ggattcttaa tacagatctc aagggccgcc tgccccggta cctcatccac cagagcctcg cggccaccat gtttgaattt gcctttcacc tgcgacagcg catcagcgag ctgggggccc gggcgtga. It is sometimes possible for the material contained within the vial of "STARD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.