Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

STIP1 cDNA Clone – Homo Sapiens Stress-Induced-Phosphoprotein 1, Mrna

STIP1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
STIP1; HOP; P60; STI1; STI1L; HEL-S-94n; IEF-SSP-3521
Synonyms
STIP1; N/A; STIP1 cDNA Clone; STIP1 cdna clone
Ordering

Product Overview

Sequence
atggagcaggtcaatgagctgaaggagaaaggcaacaaggccctgagcgtgggtaacatcgatgatgccttacagtgctactccgaagctattaagctggatccccacaaccacgtgctgtacagcaaccgttctgctgcctatgccaagaaaggagactaccagaaggcttatgaggatggctgcaagactgtcgacctaaagcctgactggggcaagggctattcacgaaaagcagcagctctagagttcttaaaccgctttgaagaagccaagcgaacctatgaggagggcttaaaacacgaggcaaataaccctcaactgaaagagggtttacagaatatggaggccaggttggcagagagaaaattcatgaaccctttcaacatgcctaatctgtatcagaagttggagagtgatcccaggacaaggacactactcagtgatcctacctaccgggagctgatagagcagctacgaaacaagccttctgacctgggcacgaaactacaagatccccggatcatgaccactctcagcgtcctccttggggtcgatctgggcagtatggatgaggaggaagagattgcaacacctccaccaccaccccctcccaaaaaggagaccaagccagagccaatggaagaagatcttccagagaataagaagcaggcactgaaagaaaaagagctggggaacgatgcctacaagaagaaagactttgacacagccttgaagcattacgacaaagccaaggagctggaccccactaacatgacttacattaccaatcaagcagcggtatactttgaaaagggcgactacaataagtgccgggagctttgtgagaaggccattgaagtggggagagaaaaccgagaagactatcgacagattgccaaagcatatgctcgaattggcaactcctacttcaaagaagaaaagtacaaggatgccatccatttctataacaagtctctggcagagcaccgaaccccagatgtgctcaagaaatgccagcaggcagagaaaatcctgaaggagcaagagcggctggcctacataaaccccgacctggctttggaggagaagaacaaaggcaacgagtgttttcagaaaggggactatccccaggccatgaagcattatacagaagccatcaaaaggaacccgaaagatgccaaattatacagcaatcgagctgcctgctacaccaaactcctggagttccagctggcactcaaggactgtgaggaatgtatccagctggagccgaccttcatcaagggttatacacggaaagccgctgcgctggaagcgatgaaggactacaccaaagccatggatgtgtaccagaaggcgctagacctggactccagctgtaaggaggcggcagacggctaccagcgctgtatgatggcgcagtacaaccggcacgacagccccgaagatgtgaagcgacgagccatggccgaccctgaggtgcagcagatcatgagtgacccagccatgcgccttatcctggaacagatgcagaaggacccccaggcactcagcgaacacttaaagaatcctgtaatagcacagaagatccagaagctgatggatgtgggtctgattgcaattcggtga
Sequence Length
1632
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,778 Da
NCBI Official Full Name
Homo sapiens stress-induced-phosphoprotein 1, mRNA
NCBI Official Synonym Full Names
stress induced phosphoprotein 1
NCBI Official Symbol
STIP1
NCBI Official Synonym Symbols
HOP; P60; STI1; STI1L; HEL-S-94n; IEF-SSP-3521
NCBI Protein Information
stress-induced-phosphoprotein 1
UniProt Protein Name
Stress-induced-phosphoprotein 1
UniProt Gene Name
STIP1
UniProt Synonym Gene Names
STI1; Hop
UniProt Entry Name
STIP1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Additional Details

Product Notes

The STIP1 stip1 (Catalog #AAA116342) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcagg tcaatgagct gaaggagaaa ggcaacaagg ccctgagcgt gggtaacatc gatgatgcct tacagtgcta ctccgaagct attaagctgg atccccacaa ccacgtgctg tacagcaacc gttctgctgc ctatgccaag aaaggagact accagaaggc ttatgaggat ggctgcaaga ctgtcgacct aaagcctgac tggggcaagg gctattcacg aaaagcagca gctctagagt tcttaaaccg ctttgaagaa gccaagcgaa cctatgagga gggcttaaaa cacgaggcaa ataaccctca actgaaagag ggtttacaga atatggaggc caggttggca gagagaaaat tcatgaaccc tttcaacatg cctaatctgt atcagaagtt ggagagtgat cccaggacaa ggacactact cagtgatcct acctaccggg agctgataga gcagctacga aacaagcctt ctgacctggg cacgaaacta caagatcccc ggatcatgac cactctcagc gtcctccttg gggtcgatct gggcagtatg gatgaggagg aagagattgc aacacctcca ccaccacccc ctcccaaaaa ggagaccaag ccagagccaa tggaagaaga tcttccagag aataagaagc aggcactgaa agaaaaagag ctggggaacg atgcctacaa gaagaaagac tttgacacag ccttgaagca ttacgacaaa gccaaggagc tggaccccac taacatgact tacattacca atcaagcagc ggtatacttt gaaaagggcg actacaataa gtgccgggag ctttgtgaga aggccattga agtggggaga gaaaaccgag aagactatcg acagattgcc aaagcatatg ctcgaattgg caactcctac ttcaaagaag aaaagtacaa ggatgccatc catttctata acaagtctct ggcagagcac cgaaccccag atgtgctcaa gaaatgccag caggcagaga aaatcctgaa ggagcaagag cggctggcct acataaaccc cgacctggct ttggaggaga agaacaaagg caacgagtgt tttcagaaag gggactatcc ccaggccatg aagcattata cagaagccat caaaaggaac ccgaaagatg ccaaattata cagcaatcga gctgcctgct acaccaaact cctggagttc cagctggcac tcaaggactg tgaggaatgt atccagctgg agccgacctt catcaagggt tatacacgga aagccgctgc gctggaagcg atgaaggact acaccaaagc catggatgtg taccagaagg cgctagacct ggactccagc tgtaaggagg cggcagacgg ctaccagcgc tgtatgatgg cgcagtacaa ccggcacgac agccccgaag atgtgaagcg acgagccatg gccgaccctg aggtgcagca gatcatgagt gacccagcca tgcgccttat cctggaacag atgcagaagg acccccaggc actcagcgaa cacttaaaga atcctgtaat agcacagaag atccagaagc tgatggatgt gggtctgatt gcaattcggt ga. It is sometimes possible for the material contained within the vial of "STIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.