TBC1D20 cdna clone
TBC1D20 cDNA Clone
Gene Names
TBC1D20; WARBM4; C20orf140
Synonyms
TBC1D20; N/A; TBC1D20 cDNA Clone; TBC1D20 cdna clone
Sequence
atggccctccggagtgcgcagggcgacggccccacctccggccactgggacggcggcgcggagaaggcagactttaacgccaaaaggaaaaagaaagtggcagagatacaccaggctctgaacagtgatcccactgatgtggctgcccttagacgcatggctatcagtgaaggagggctcctgactgatgagatcagacgaaaagtgtggcccaagctcctcaatgtcaatgccaatgacccacctcctatatcagggaagaacctacggcagatgagcaaggactaccaacaagtgttgctggacgtccggcggtcattgcggcggttccctcctggcatgccagaggaacagagagaagggctccaggaagaactgattgacatcatcctcctcatcttggagcgcaaccctcagctgcactactaccagggctaccatgacattgtggtcacatttctgctggtggtaggcgagaggctggcaacatccctggtagaaaaattatctacccaccacctcagggattttatggatccaacaatggacaacaccaagcatatattaaactatctgatgcccatcattgaccaggtgaatccagagctccatgacttcatgcagagtgctgaggtagggaccatctttgccctcagctggctcatcacctggtttgggcatgtcctgtctgacttcaggcacgtcgtgcggttatatgacttcttcctggcctgccacccactgatgccgatttactttgcagccgtgattgtgttgtatcgcgagcaggaagtcctggactgtgactgtgacatggcctcggtccaccacctgttgtcccagatccctcaggacttgccctatgagacactgatcagcagagcaggagacctttttgttcagtttcccccatccgaacttgctcgggaggccgctgcccaacagcaagctgagaggacggcagcctctactttcaaagactttgagctggcatcagcccagcagaggcctgatatggtgctgcggcagcggtttcggggacttctgcggcctgaagatcgaacaaaagatgtcctgaccaagccaaggaccaaccgctttgtgaaattggcagtgatggggctgacagtggcacttggagcggctgcactggctgtggtgaaaagtgccctggaatgggcccctaagtttcagctgcagctgtttccctga
Sequence Length
1212
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,382 Da
NCBI Official Full Name
Homo sapiens TBC1 domain family, member 20, mRNA
NCBI Official Synonym Full Names
TBC1 domain family member 20
NCBI Official Symbol
TBC1D20
NCBI Official Synonym Symbols
WARBM4; C20orf140
NCBI Protein Information
TBC1 domain family member 20
UniProt Protein Name
TBC1 domain family member 20
UniProt Gene Name
TBC1D20
UniProt Synonym Gene Names
C20orf140
UniProt Entry Name
TBC20_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The TBC1D20 tbc1d20 (Catalog #AAA116361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctcc ggagtgcgca gggcgacggc cccacctccg gccactggga cggcggcgcg gagaaggcag actttaacgc caaaaggaaa aagaaagtgg cagagataca ccaggctctg aacagtgatc ccactgatgt ggctgccctt agacgcatgg ctatcagtga aggagggctc ctgactgatg agatcagacg aaaagtgtgg cccaagctcc tcaatgtcaa tgccaatgac ccacctccta tatcagggaa gaacctacgg cagatgagca aggactacca acaagtgttg ctggacgtcc ggcggtcatt gcggcggttc cctcctggca tgccagagga acagagagaa gggctccagg aagaactgat tgacatcatc ctcctcatct tggagcgcaa ccctcagctg cactactacc agggctacca tgacattgtg gtcacatttc tgctggtggt aggcgagagg ctggcaacat ccctggtaga aaaattatct acccaccacc tcagggattt tatggatcca acaatggaca acaccaagca tatattaaac tatctgatgc ccatcattga ccaggtgaat ccagagctcc atgacttcat gcagagtgct gaggtaggga ccatctttgc cctcagctgg ctcatcacct ggtttgggca tgtcctgtct gacttcaggc acgtcgtgcg gttatatgac ttcttcctgg cctgccaccc actgatgccg atttactttg cagccgtgat tgtgttgtat cgcgagcagg aagtcctgga ctgtgactgt gacatggcct cggtccacca cctgttgtcc cagatccctc aggacttgcc ctatgagaca ctgatcagca gagcaggaga cctttttgtt cagtttcccc catccgaact tgctcgggag gccgctgccc aacagcaagc tgagaggacg gcagcctcta ctttcaaaga ctttgagctg gcatcagccc agcagaggcc tgatatggtg ctgcggcagc ggtttcgggg acttctgcgg cctgaagatc gaacaaaaga tgtcctgacc aagccaagga ccaaccgctt tgtgaaattg gcagtgatgg ggctgacagt ggcacttgga gcggctgcac tggctgtggt gaaaagtgcc ctggaatggg cccctaagtt tcagctgcag ctgtttccct ga. It is sometimes possible for the material contained within the vial of "TBC1D20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.