TBX18 cdna clone
TBX18 cDNA Clone
Gene Names
TBX18; CAKUT2
Synonyms
TBX18; N/A; TBX18 cDNA Clone; TBX18 cdna clone
Sequence
atggccgagaagcgaaggggctcgccgtgcagcatgctaagcctcaaggcgcacgctttctcggtggaggcgctgatcggcgccgagaagcagcaacagcttcagaagaagcggcgaaaactgggcgccgaagaggcggcgagggccgtggacgacggaggctgcagccgcggcggcggcgcgggcgaaaagggttcttctgagggagacgaaggcgctgcgctcccgccgccggctggggcgacgtctgggccggctcggagtggcgcagacctggagcgcggagccgcgggcggctgtgaggacggcttccagcagggagcttcccctctggcgtcaccgggaggctcccccaaggggtctccggcgcgctccctggcccggcccgggacccctctgccctcgccgcaggccccgcgggtggatctgcagggagccgagctctggaagcgctttcatgagataggcactgagatgatcatcaccaaggccggcaggcgcatgtttccagcaatgagagtgaagatctctggattagatcctcaccagcaatattacattgccatggatattgtaccagtggacaacaaaagatacaggtatgtttaccacagttcgaaatggatggtggcaggtaatgctgactcgcctgtgccaccccgtgtgtacattcatccagactcgcctgcctcgggggagacttggatgagacaagttatcagcttcgacaagctgaagctcaccaacaatgaactggatgaccaaggccatattattcttcattctatgcacaaataccaaccgcgagtgcacgtcatccgtaaagactgtggagacgatctttctcccatcaagcctgttccatccggggagggagtaaaggcattctcctttccagaaactgtcttcacaaccgtcactgcctatcagaatcagcagattactcgcctgaagatagataggaatccatttgctaaaggcttccgagactccgggcgcaacagaatgggtttggaagccttggtggaatcatatgcattctggcgaccatcactacggactctgacctttgaagatatccctggaattcccaagcaaggcaatgcaagttcctccaccttgctccaaggtactgggaatggcgttcctgccactcaccctcaccttttgtctggctcctcttgctcctctcctgccttccatctggggcccaacaccagccagctgtgtagtctggcccctgctgactattctgcctgtgcccgctcaggcctcaccctcaaccgatacagcacatctttggcagagacctacaacaggctcaccaaccaggctggtgagacctttgccccgcccaggactccctcctatgtgggcgtgagcagcagcacctccgtgaacatgtccatgggtggcactgatggggacaccttcagctgcccacagaccagcttatccatgcagatttcgggaatgtccccccagctccagtatatcatgccatcaccctccagcaatgccttcgccactaaccagacccatcagggttcctataatacttttagattacacagcccctgtgcactatatggatataacttctccacatcccccaaactggctgccagtcctgagaaaattgtttcttcccaaggaagtttcttggggtcctcaccgagtgggaccatgacggatcggcagatgttgccccctgtggaaggagtgcacctgcttagcagtgggggtcagcagagtttctttgactctaggaccctaggaagcttaactctgtcatcatctcaagtatctgcacatatggtctga
Sequence Length
1824
Vector
pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,753 Da
NCBI Official Full Name
Homo sapiens T-box 18, mRNA
NCBI Official Synonym Full Names
T-box 18
NCBI Official Symbol
TBX18
NCBI Official Synonym Symbols
CAKUT2
NCBI Protein Information
T-box transcription factor TBX18
UniProt Protein Name
T-box transcription factor TBX18
UniProt Gene Name
TBX18
UniProt Synonym Gene Names
T-box protein 18
UniProt Entry Name
TBX18_HUMAN
Similar Products
Product Notes
The TBX18 tbx18 (Catalog #AAA116325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgaga agcgaagggg ctcgccgtgc agcatgctaa gcctcaaggc gcacgctttc tcggtggagg cgctgatcgg cgccgagaag cagcaacagc ttcagaagaa gcggcgaaaa ctgggcgccg aagaggcggc gagggccgtg gacgacggag gctgcagccg cggcggcggc gcgggcgaaa agggttcttc tgagggagac gaaggcgctg cgctcccgcc gccggctggg gcgacgtctg ggccggctcg gagtggcgca gacctggagc gcggagccgc gggcggctgt gaggacggct tccagcaggg agcttcccct ctggcgtcac cgggaggctc ccccaagggg tctccggcgc gctccctggc ccggcccggg acccctctgc cctcgccgca ggccccgcgg gtggatctgc agggagccga gctctggaag cgctttcatg agataggcac tgagatgatc atcaccaagg ccggcaggcg catgtttcca gcaatgagag tgaagatctc tggattagat cctcaccagc aatattacat tgccatggat attgtaccag tggacaacaa aagatacagg tatgtttacc acagttcgaa atggatggtg gcaggtaatg ctgactcgcc tgtgccaccc cgtgtgtaca ttcatccaga ctcgcctgcc tcgggggaga cttggatgag acaagttatc agcttcgaca agctgaagct caccaacaat gaactggatg accaaggcca tattattctt cattctatgc acaaatacca accgcgagtg cacgtcatcc gtaaagactg tggagacgat ctttctccca tcaagcctgt tccatccggg gagggagtaa aggcattctc ctttccagaa actgtcttca caaccgtcac tgcctatcag aatcagcaga ttactcgcct gaagatagat aggaatccat ttgctaaagg cttccgagac tccgggcgca acagaatggg tttggaagcc ttggtggaat catatgcatt ctggcgacca tcactacgga ctctgacctt tgaagatatc cctggaattc ccaagcaagg caatgcaagt tcctccacct tgctccaagg tactgggaat ggcgttcctg ccactcaccc tcaccttttg tctggctcct cttgctcctc tcctgccttc catctggggc ccaacaccag ccagctgtgt agtctggccc ctgctgacta ttctgcctgt gcccgctcag gcctcaccct caaccgatac agcacatctt tggcagagac ctacaacagg ctcaccaacc aggctggtga gacctttgcc ccgcccagga ctccctccta tgtgggcgtg agcagcagca cctccgtgaa catgtccatg ggtggcactg atggggacac cttcagctgc ccacagacca gcttatccat gcagatttcg ggaatgtccc cccagctcca gtatatcatg ccatcaccct ccagcaatgc cttcgccact aaccagaccc atcagggttc ctataatact tttagattac acagcccctg tgcactatat ggatataact tctccacatc ccccaaactg gctgccagtc ctgagaaaat tgtttcttcc caaggaagtt tcttggggtc ctcaccgagt gggaccatga cggatcggca gatgttgccc cctgtggaag gagtgcacct gcttagcagt gggggtcagc agagtttctt tgactctagg accctaggaa gcttaactct gtcatcatct caagtatctg cacatatggt ctga. It is sometimes possible for the material contained within the vial of "TBX18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.