Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

TRPM1 cdna clone

TRPM1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
TRPM1; MLSN1; CSNB1C; LTRPC1
Synonyms
TRPM1; N/A; TRPM1 cDNA Clone; TRPM1 cdna clone
Ordering
Sequence
atgaaagactctaacaggtgttgctgtggccagttcaccaaccagcatatcccccctctgccaagtgcaacacccagcaaaaatgaagaggaaaacaaacaggtggagactcagcctgagaaatggtctgttgccaagcacacccagagctacccaacagattcctatggagttcttgaattccagggtggcggatattccaataaagccatggtgagaaaggcattcagacatggtgccactaggatcacagctttcattggcggccagtctcccagccccaaactgcagatacctggtcttcttcatggctgtggctcaatcttcctagatatttcattgaaaaaccaagagatatatctgtgcacatggcttttagccatgaggcttggaaactggacaccactgtaa
Sequence Length
411
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,099 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily M, member 1, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily M member 1
NCBI Official Symbol
TRPM1
NCBI Official Synonym Symbols
MLSN1; CSNB1C; LTRPC1
NCBI Protein Information
transient receptor potential cation channel subfamily M member 1
UniProt Protein Name
Transient receptor potential cation channel subfamily M member 1
UniProt Gene Name
TRPM1
UniProt Synonym Gene Names
LTrpC1
UniProt Entry Name
TRPM1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The TRPM1 trpm1 (Catalog #AAA116230) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagact ctaacaggtg ttgctgtggc cagttcacca accagcatat cccccctctg ccaagtgcaa cacccagcaa aaatgaagag gaaaacaaac aggtggagac tcagcctgag aaatggtctg ttgccaagca cacccagagc tacccaacag attcctatgg agttcttgaa ttccagggtg gcggatattc caataaagcc atggtgagaa aggcattcag acatggtgcc actaggatca cagctttcat tggcggccag tctcccagcc ccaaactgca gatacctggt cttcttcatg gctgtggctc aatcttccta gatatttcat tgaaaaacca agagatatat ctgtgcacat ggcttttagc catgaggctt ggaaactgga caccactgta a. It is sometimes possible for the material contained within the vial of "TRPM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.