Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

TTLL7 cdna clone

TTLL7 cDNA Clone

Synonyms
TTLL7; N/A; TTLL7 cDNA Clone; TTLL7 cdna clone
Ordering
Sequence
atgccatctctgcctcaagaaggagttattcagggaccctctcccctggatttgaatacagaattaccttatcaaagcacaatgaaaaggaaagtcagaaagaagaaaaagaagggaaccattacagcaaatgttgccgggacaaagtttgaaattgttcgtttagtaatagatgaaatgggatttatgaaaactccagatgaggatgaaacaagtaatcttatatggtgtgattctgctgttcagcaggagaaaatttcagagctgcaaaattatcagaggatcaaccattttccaggaatgggggagatctgtaggaaggatttcttagcaagaaatatgaccaaaatgatcaagtctcggcctctggattatacctttgttcctcgaacttggatctttcctgctgaatatactcaattccaaaattatgtgaaagaattgaagaaaaaacggaagcagaaaacttttatagtgaaacgagctaatggtgcaatgggtcatgggatttctttgataagaaatggtgacaaacttccatctcaggatcatttgattgttcaagaatacattgaaaagcctttcctaatggaaggttacaagtttgacttacgaatttatattctggttacatcgtgtgatccactaaaaatatttctctaccatgatgggcttgtgcgaatgggtacagagaagtacattccacctaatgagtccaatttgacccagttatacatgcatctgacaaactactccgtgaacaagcataatgagcattttgaacgggatgaaactgagaacaaaggcagcaaacgttccatcaaatggtttacagaattccttcaagcaaatcaacatgatgttgctaagttttggagtgatatttcagaattggtggtaaagaccctgattgtagcagaacctcatgtcctgcatgcctatcgaatgtgtagacctggtcaacctccaggaagcgaaagtgtctgctttgaagtcctgggatttgatattttgttggatagaaaactaaagccatggcttctggagattaaccgagccccaagctttggaactgatcagaaaatagactatgatgtaaaaaggggagtgctgctaaatgcgttgaagctactaaacataaggaccagtgacaaaagaagaaacttggccaaacaaaaagctgaggctcaaaggaggctctatggtcaaaattcaattaaaaggctcttaccaggctcctcagactgggaacagcagagacaccagttggagaggcggaaagaagagttgaaagagagactcgctcaagtacgaaagcagatctcacgagaagaacatgaaaatcgacatatggggaattatagacgaatttatcctcctgaagataaagcattacttgaaaagtatgaaaatttgttagctgttgcctttcagaccttcctttcaggaagagcagcttcattccagcgagagttgaataatcctttgaaaaggatgaaggaagaagatattttggatcttctggagcaatgtgaaattgatgatgaaaagttgatgggaaaaactaccaagactcgaggaccaaagggtcgaataactcattatgtagtcaagctctttaagaacacttaa
Sequence Length
1632
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,222 Da
NCBI Official Full Name
Homo sapiens tubulin tyrosine ligase-like family, member 7, mRNA
NCBI Official Synonym Full Names
tubulin tyrosine ligase like 7
NCBI Official Symbol
TTLL7
NCBI Protein Information
tubulin polyglutamylase TTLL7
UniProt Protein Name
Tubulin polyglutamylase TTLL7
UniProt Gene Name
TTLL7
UniProt Entry Name
TTLL7_HUMAN

Similar Products

Product Notes

The TTLL7 ttll7 (Catalog #AAA116224) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccatctc tgcctcaaga aggagttatt cagggaccct ctcccctgga tttgaataca gaattacctt atcaaagcac aatgaaaagg aaagtcagaa agaagaaaaa gaagggaacc attacagcaa atgttgccgg gacaaagttt gaaattgttc gtttagtaat agatgaaatg ggatttatga aaactccaga tgaggatgaa acaagtaatc ttatatggtg tgattctgct gttcagcagg agaaaatttc agagctgcaa aattatcaga ggatcaacca ttttccagga atgggggaga tctgtaggaa ggatttctta gcaagaaata tgaccaaaat gatcaagtct cggcctctgg attatacctt tgttcctcga acttggatct ttcctgctga atatactcaa ttccaaaatt atgtgaaaga attgaagaaa aaacggaagc agaaaacttt tatagtgaaa cgagctaatg gtgcaatggg tcatgggatt tctttgataa gaaatggtga caaacttcca tctcaggatc atttgattgt tcaagaatac attgaaaagc ctttcctaat ggaaggttac aagtttgact tacgaattta tattctggtt acatcgtgtg atccactaaa aatatttctc taccatgatg ggcttgtgcg aatgggtaca gagaagtaca ttccacctaa tgagtccaat ttgacccagt tatacatgca tctgacaaac tactccgtga acaagcataa tgagcatttt gaacgggatg aaactgagaa caaaggcagc aaacgttcca tcaaatggtt tacagaattc cttcaagcaa atcaacatga tgttgctaag ttttggagtg atatttcaga attggtggta aagaccctga ttgtagcaga acctcatgtc ctgcatgcct atcgaatgtg tagacctggt caacctccag gaagcgaaag tgtctgcttt gaagtcctgg gatttgatat tttgttggat agaaaactaa agccatggct tctggagatt aaccgagccc caagctttgg aactgatcag aaaatagact atgatgtaaa aaggggagtg ctgctaaatg cgttgaagct actaaacata aggaccagtg acaaaagaag aaacttggcc aaacaaaaag ctgaggctca aaggaggctc tatggtcaaa attcaattaa aaggctctta ccaggctcct cagactggga acagcagaga caccagttgg agaggcggaa agaagagttg aaagagagac tcgctcaagt acgaaagcag atctcacgag aagaacatga aaatcgacat atggggaatt atagacgaat ttatcctcct gaagataaag cattacttga aaagtatgaa aatttgttag ctgttgcctt tcagaccttc ctttcaggaa gagcagcttc attccagcga gagttgaata atcctttgaa aaggatgaag gaagaagata ttttggatct tctggagcaa tgtgaaattg atgatgaaaa gttgatggga aaaactacca agactcgagg accaaagggt cgaataactc attatgtagt caagctcttt aagaacactt aa. It is sometimes possible for the material contained within the vial of "TTLL7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.